ID: 1074481702

View in Genome Browser
Species Human (GRCh38)
Location 10:113828160-113828182
Sequence TACGGGACCCTGAGAGCGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074481702_1074481707 1 Left 1074481702 10:113828160-113828182 CCACTCGCTCTCAGGGTCCCGTA No data
Right 1074481707 10:113828184-113828206 ATACAGGGTCAGCCTTAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074481702 Original CRISPR TACGGGACCCTGAGAGCGAG TGG (reversed) Intergenic
No off target data available for this crispr