ID: 1074483593

View in Genome Browser
Species Human (GRCh38)
Location 10:113852035-113852057
Sequence GCCCCAGTTGGTGGTTATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 106}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074483593_1074483608 30 Left 1074483593 10:113852035-113852057 CCATAATAACCACCAACTGGGGC 0: 1
1: 0
2: 1
3: 7
4: 106
Right 1074483608 10:113852088-113852110 GCACTTTGGGAGGCCGAGGCGGG 0: 84291
1: 218536
2: 234154
3: 158283
4: 172560
1074483593_1074483604 20 Left 1074483593 10:113852035-113852057 CCATAATAACCACCAACTGGGGC 0: 1
1: 0
2: 1
3: 7
4: 106
Right 1074483604 10:113852078-113852100 TGTAATACCAGCACTTTGGGAGG 0: 2483
1: 305180
2: 267017
3: 149473
4: 133752
1074483593_1074483601 16 Left 1074483593 10:113852035-113852057 CCATAATAACCACCAACTGGGGC 0: 1
1: 0
2: 1
3: 7
4: 106
Right 1074483601 10:113852074-113852096 TGCCTGTAATACCAGCACTTTGG 0: 878
1: 96882
2: 236235
3: 242529
4: 214970
1074483593_1074483602 17 Left 1074483593 10:113852035-113852057 CCATAATAACCACCAACTGGGGC 0: 1
1: 0
2: 1
3: 7
4: 106
Right 1074483602 10:113852075-113852097 GCCTGTAATACCAGCACTTTGGG 0: 1784
1: 228564
2: 275882
3: 182837
4: 140649
1074483593_1074483605 26 Left 1074483593 10:113852035-113852057 CCATAATAACCACCAACTGGGGC 0: 1
1: 0
2: 1
3: 7
4: 106
Right 1074483605 10:113852084-113852106 ACCAGCACTTTGGGAGGCCGAGG 0: 898
1: 122646
2: 271853
3: 213268
4: 126667
1074483593_1074483607 29 Left 1074483593 10:113852035-113852057 CCATAATAACCACCAACTGGGGC 0: 1
1: 0
2: 1
3: 7
4: 106
Right 1074483607 10:113852087-113852109 AGCACTTTGGGAGGCCGAGGCGG 0: 87986
1: 182858
2: 138884
3: 74939
4: 51691

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074483593 Original CRISPR GCCCCAGTTGGTGGTTATTA TGG (reversed) Intronic
905942164 1:41872791-41872813 TCCCCAGTTGATGGGTATTTGGG + Intronic
907578187 1:55547491-55547513 GGCCCATTTGGTGTTAATTATGG + Intergenic
909027659 1:70501631-70501653 ACCCCATTTGGGGGTTTTTATGG + Intergenic
916553327 1:165871113-165871135 GCCCCTGTTAGTGTTTAGTATGG + Intronic
921102777 1:211944900-211944922 GCGCCAGCTGCTGGTTATTCTGG + Exonic
922749437 1:228063701-228063723 GGCCCAGTAGGTGCTAATTAGGG - Intergenic
923098324 1:230793038-230793060 AGCCCAGTTGGTGATTCTTAAGG + Intronic
924434958 1:244031022-244031044 GCCCCATTTGGGGGTTATTTGGG - Intergenic
1069522783 10:69138264-69138286 TCACCAGTTGGTGGGTATTTGGG + Intronic
1069689608 10:70341397-70341419 TCCCCAGTTGGTGGACATTTGGG - Intronic
1069880093 10:71587068-71587090 GCCACATTTGGGGGTTATGATGG - Intronic
1072748254 10:97957394-97957416 GCCCCAGCTGATGTTTATTGAGG + Intronic
1073361234 10:102900782-102900804 GCCCCATTTGTTGTTTCTTATGG - Exonic
1074483593 10:113852035-113852057 GCCCCAGTTGGTGGTTATTATGG - Intronic
1074878806 10:117635360-117635382 GCCCCTGTTGGTAGTAAGTATGG - Intergenic
1075217627 10:120552118-120552140 GCCCCAGGTGGTGATAATGATGG + Intronic
1075935665 10:126339021-126339043 GCCCAAGTTGGTGTGTATTTTGG - Intronic
1079318767 11:19432413-19432435 GACTGAGTTGGTGGTGATTAAGG + Intronic
1080650039 11:34215025-34215047 GCCCCAGGTGGTGGTGACTCAGG + Intronic
1081862800 11:46343373-46343395 GCACCAGATGGAGGTTTTTAAGG + Intronic
1090394243 11:126408317-126408339 GCCCCAGTGGCTGGCTATGAGGG + Exonic
1091645230 12:2268047-2268069 GCCCCATATGGTTGTTATTCTGG - Intronic
1092704034 12:11264793-11264815 GCTCAACTTGGTGGTGATTATGG + Intergenic
1092781460 12:11991454-11991476 GCCCCACTGGATGGTTATTGTGG - Intergenic
1097238824 12:57559118-57559140 GCCTCTGTTGGTGGACATTAAGG + Intronic
1098607709 12:72413025-72413047 GACCCAGATGGTGATTATTTGGG + Intronic
1101295483 12:103419396-103419418 GCCCCAGGTGGAAGTTGTTATGG + Intronic
1102904295 12:116662447-116662469 GCCTCAGTTTGGGGTTCTTAAGG + Intergenic
1105636109 13:22216685-22216707 AGCCCTGTTGGTGGTTCTTAAGG + Intergenic
1107099450 13:36574049-36574071 GCACCAGTGGGTGGTAATGAAGG - Intergenic
1112209436 13:97361206-97361228 GCACCAGGTGGTGGTTACGAAGG + Intronic
1117433235 14:55691323-55691345 GCTCCAGTTGGTGGTTCTCTTGG + Intronic
1118868720 14:69723934-69723956 GCCCATGTTGGTGATTATTTAGG - Intergenic
1120101184 14:80447398-80447420 TCCCCAGTTGATGGATATTTAGG + Intergenic
1120156283 14:81096748-81096770 GCCCCATTGGATGGTTCTTAGGG - Intronic
1121291991 14:92783522-92783544 GCCTCAGTTGGTGGTTTATAAGG - Intergenic
1123037523 14:105477510-105477532 GGCCCAGTTGGTGGGGATCAGGG + Intronic
1128459320 15:67854440-67854462 GCCCCAGTGGCAGGTTATTAGGG - Intergenic
1129079142 15:73024030-73024052 GGCCCAGGTGCAGGTTATTATGG + Intergenic
1131658421 15:94485784-94485806 GGCCTAGGTTGTGGTTATTAGGG - Intergenic
1132395900 15:101474287-101474309 GTCCCAGTTGGAGTTTATTTAGG - Intronic
1138903716 16:61304791-61304813 GCCACAGTTTGTGGATACTAAGG + Intergenic
1144470939 17:15540546-15540568 GTCCCAGGCGGTGGTTATTATGG - Intronic
1144925530 17:18804131-18804153 GTCCCAGGCGGTGGTTATCATGG + Exonic
1150514201 17:65790493-65790515 GCCCAAGCTGGTGGTTTTTGAGG - Intronic
1150834324 17:68550923-68550945 GCCCCAGTAGATGGTTCTAAGGG - Intronic
1152799437 17:82324018-82324040 GCCCCTGTTCGTGGTCACTAAGG + Intronic
1161081903 19:2315348-2315370 ACCCCACTTGGTGGTCATGATGG + Intronic
1164614517 19:29658747-29658769 GCCCCTGTCAGTGGATATTAGGG + Intergenic
928176248 2:29036207-29036229 GCCCCAGTTGTTGTTGTTTATGG + Intronic
929018420 2:37525411-37525433 GCCTCAGGTGGTGTTTCTTATGG + Intergenic
930002669 2:46871525-46871547 CCCCCAGTTGGTGCTTTTTCTGG + Intergenic
930101074 2:47603676-47603698 TCCCCAGTTGATGGACATTAGGG + Intergenic
932096251 2:68851524-68851546 ACCTCAGTTGGTGTTTATTAAGG - Intergenic
932296769 2:70630875-70630897 GCCCCAGTTGGCAGTTATAAAGG + Intronic
932446501 2:71785033-71785055 TCCCCACCTGGTGGTTATCAGGG - Intergenic
933800868 2:85959431-85959453 GCTGCAGTTGCTGGCTATTACGG + Intergenic
936024708 2:109022262-109022284 ACCACAGTTGCTGGTTATTGAGG - Intergenic
946434556 2:219643092-219643114 TCCCCAGGTGGAGGTTGTTAGGG - Intergenic
948851669 2:240711338-240711360 GCTCCAGGTGGTGGTTGGTAGGG + Intergenic
1170609096 20:17897099-17897121 GCCCCTGTTGGTGGTGATGGTGG - Intergenic
1173071083 20:39766304-39766326 ACCCCAATTGGTAGTTTTTAGGG - Intergenic
1175877254 20:62236321-62236343 CCCTCAGTTGGTGGGTAGTAAGG - Intronic
1178354860 21:31902049-31902071 GTCCCAGTTGGAGGTTTATATGG - Intronic
1178354941 21:31902614-31902636 GTCCCAGTTGGAGGTTTATATGG + Intronic
1184356915 22:43987517-43987539 GCACCAGGTGGTGGTTAGAAGGG + Intronic
1184881762 22:47309878-47309900 CCACCTGTTGGTGGTTATTTGGG + Intergenic
950562871 3:13745561-13745583 CACCCAGTAGGTGCTTATTAAGG - Intergenic
953126129 3:40093336-40093358 TTGCCAGGTGGTGGTTATTAAGG - Intronic
955214903 3:56977214-56977236 GCCCCAGTTTGTGGCTCTTGTGG - Intronic
959616481 3:108353953-108353975 TCCCCTGTTGGTGGGTATTCAGG + Intronic
960515197 3:118595556-118595578 GCCCCAGTGGGTGGGTGTTACGG + Intergenic
964608297 3:158582327-158582349 GCCACAGTTCTTGGATATTATGG - Intronic
967656621 3:192057786-192057808 TCCCAATTTGGTGGTTACTATGG - Intergenic
967685097 3:192409209-192409231 GGCACAGTTGGTGATTATTTAGG + Intronic
968229020 3:196993536-196993558 GCTCCAGTTGGTGGAATTTAAGG - Intronic
969692075 4:8709300-8709322 CCCCCAGTTTGTGGTTATTATGG + Intergenic
971599637 4:28575958-28575980 TCCCCAGTTGATAGTTTTTAGGG + Intergenic
975481456 4:74885218-74885240 GCCCCAGTTGGTGGGTAAAGAGG + Intergenic
976573992 4:86647643-86647665 GTCCTATTTGGAGGTTATTAGGG - Intronic
979709265 4:123758557-123758579 GCCTCAGGTGTTGGGTATTAGGG + Intergenic
979972483 4:127154049-127154071 TCACCAGTTGATGGTTATTTGGG - Intergenic
982529399 4:156520289-156520311 GCTCCAGTTTGTGTTCATTAGGG - Intergenic
988521993 5:31954627-31954649 GCCCCTCTTAGTGGTTTTTATGG - Intronic
991744249 5:69716679-69716701 GCCACAGTTTGGGGTTATTTTGG - Intergenic
991753457 5:69838557-69838579 GCCACAGTTTGGGGTTATTTTGG + Intergenic
991795821 5:70296403-70296425 GCCACAGTTTGGGGTTATTTTGG - Intergenic
991803074 5:70395284-70395306 GCCACAGTTTGGGGTTATTTTGG + Intergenic
991823623 5:70591947-70591969 GCCACAGTTTGGGGTTATTTTGG - Intergenic
991832776 5:70713682-70713704 GCCACAGTTTGGGGTTATTTTGG + Intergenic
991888191 5:71295922-71295944 GCCACAGTTTGGGGTTATTTTGG - Intergenic
992139110 5:73778135-73778157 GCACCAAGTGGTGGTTATTCTGG + Intronic
994162951 5:96577141-96577163 GTCCCAGTTTGTGGTTTTTCAGG + Intronic
1001085661 5:168698612-168698634 CACCCAGTCTGTGGTTATTATGG + Intronic
1001345758 5:170896931-170896953 GACCCAGTTGGTGGTCATACTGG + Intronic
1005621809 6:27627264-27627286 GCCCAAATTGGAGGATATTAGGG - Intergenic
1011125044 6:83998304-83998326 GCCCCAGGTGATTGTTATGATGG - Intergenic
1015818669 6:137236973-137236995 TCACCAGTTGGTGGTCATTTGGG + Intergenic
1016261719 6:142179466-142179488 GCCCCTGTTGGTGGACATCAGGG - Intronic
1019535950 7:1530042-1530064 GCCCCAGCTGGTGGTTGCCAGGG - Intergenic
1021809271 7:24387395-24387417 ACCCCAGTTGGTGGGTGCTATGG - Intergenic
1026083388 7:67241995-67242017 GCCATAGTTAGTGGTTGTTACGG + Intergenic
1031351041 7:120731414-120731436 CCCCCAGATGGTGATTATTCAGG - Intronic
1036195503 8:6709814-6709836 GCCCCAGTTGGAAGTTGTTTGGG + Intronic
1036599097 8:10242491-10242513 GACCCAGGTGGTGGTTGTAAGGG + Intronic
1041168823 8:55119527-55119549 GCCCAAGTTGCTGGTTAGTTTGG - Intronic
1047626920 8:126665888-126665910 CACCCAGTTTGTGGTAATTACGG + Intergenic
1056289796 9:85131583-85131605 TTCCCAGTTGCTGGTGATTAGGG - Intergenic
1061422713 9:130480797-130480819 GCCCGATTTCGTGGTCATTAAGG + Intronic
1061884627 9:133585326-133585348 GGCCCAGATGGTGGTTAGCAGGG - Intronic
1185829540 X:3287007-3287029 GCCTCAGTTGGGGCTAATTAAGG + Intergenic
1187571181 X:20504202-20504224 GGCCAAGATGGTGGTTATTCAGG + Intergenic
1198502677 X:137267667-137267689 GCTCTGGTTGGTGGATATTAGGG + Intergenic
1202356353 Y:24053787-24053809 TCCCACATTGGTGGTTATTAAGG + Intergenic
1202514425 Y:25616322-25616344 TCCCACATTGGTGGTTATTAAGG - Intergenic