ID: 1074483975

View in Genome Browser
Species Human (GRCh38)
Location 10:113854990-113855012
Sequence CAGTATCTGCAGAAGGTGGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 0, 2: 0, 3: 39, 4: 322}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074483967_1074483975 12 Left 1074483967 10:113854955-113854977 CCGTTACCCAGCAGGAGAAGGAC 0: 1
1: 0
2: 0
3: 17
4: 182
Right 1074483975 10:113854990-113855012 CAGTATCTGCAGAAGGTGGACGG 0: 1
1: 0
2: 0
3: 39
4: 322
1074483969_1074483975 5 Left 1074483969 10:113854962-113854984 CCAGCAGGAGAAGGACAGCCTGG 0: 1
1: 0
2: 1
3: 39
4: 498
Right 1074483975 10:113854990-113855012 CAGTATCTGCAGAAGGTGGACGG 0: 1
1: 0
2: 0
3: 39
4: 322
1074483968_1074483975 6 Left 1074483968 10:113854961-113854983 CCCAGCAGGAGAAGGACAGCCTG 0: 1
1: 0
2: 3
3: 32
4: 389
Right 1074483975 10:113854990-113855012 CAGTATCTGCAGAAGGTGGACGG 0: 1
1: 0
2: 0
3: 39
4: 322
1074483963_1074483975 24 Left 1074483963 10:113854943-113854965 CCCTGCTCGACGCCGTTACCCAG 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1074483975 10:113854990-113855012 CAGTATCTGCAGAAGGTGGACGG 0: 1
1: 0
2: 0
3: 39
4: 322
1074483964_1074483975 23 Left 1074483964 10:113854944-113854966 CCTGCTCGACGCCGTTACCCAGC 0: 1
1: 0
2: 0
3: 0
4: 32
Right 1074483975 10:113854990-113855012 CAGTATCTGCAGAAGGTGGACGG 0: 1
1: 0
2: 0
3: 39
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074483975 Original CRISPR CAGTATCTGCAGAAGGTGGA CGG Exonic
900002898 1:24753-24775 CAGTACCTGCAGAAGGTCTCTGG - Intergenic
900022618 1:195278-195300 CAGTACCTGCAGAAGGTCTCTGG - Intergenic
900484898 1:2917853-2917875 CAGAGCCTGCAGAAGCTGGAAGG - Intergenic
902839955 1:19068308-19068330 CAGCATCTGCAGCAGGTTGCGGG - Intergenic
902878346 1:19354428-19354450 AAGTAACTACAGAAGGGGGAGGG - Intronic
903997698 1:27318030-27318052 CAGTATATGCAGCATGTGGGAGG - Intergenic
904302117 1:29561203-29561225 CAATCTCTGGAGAAGGGGGATGG + Intergenic
906050487 1:42867412-42867434 CATTATCTGCAGAAGATGGCAGG - Intergenic
906209283 1:44003153-44003175 CAGGGGCTGCAGCAGGTGGAGGG - Intronic
907371878 1:54009067-54009089 CAGTACTTGAAGAAGGTTGAAGG + Exonic
908439662 1:64141303-64141325 CAGCTTCTGCAGAAGGTGAACGG + Intronic
908860830 1:68486345-68486367 CAGTCATGGCAGAAGGTGGAGGG - Intronic
909172609 1:72315466-72315488 AATTATCTGCAGAAGATGGCAGG + Intergenic
909288699 1:73854686-73854708 CTGTATCTGCAGGTGGTGGTGGG - Intergenic
909685138 1:78339437-78339459 CAGTATTTGCTGAAAGTAGAAGG - Intronic
910588215 1:88901724-88901746 AATTATCTGCAGAAGATGGCAGG - Intergenic
910625050 1:89297632-89297654 CTGTATCTGCACATGATGGAAGG - Intergenic
910638992 1:89439976-89439998 CATTATCTGCAGAAGATGGCAGG + Intergenic
911320984 1:96413736-96413758 AGCTATCTGCAGAAAGTGGATGG + Intergenic
911386140 1:97177938-97177960 CTGTATCTTCACATGGTGGAAGG + Intronic
911467374 1:98272531-98272553 CAGTTTCCTCACAAGGTGGAAGG - Intergenic
911686119 1:100779792-100779814 CAATCTTTGCAGAAGGTGAAAGG + Intergenic
915874100 1:159594152-159594174 CACAGACTGCAGAAGGTGGATGG + Intergenic
917895730 1:179484990-179485012 CAGTGGCTGCACAAGGTGGGAGG - Intronic
918922041 1:190725148-190725170 CTGTGTCCTCAGAAGGTGGAAGG + Intergenic
919109359 1:193198425-193198447 CAGTGTCTTCACATGGTGGAAGG - Intronic
920818397 1:209356951-209356973 GAGTTTCTGCATCAGGTGGAAGG + Intergenic
922072828 1:222213200-222213222 CAATATTGGCAGAAGGGGGAGGG + Intergenic
922162968 1:223091660-223091682 CAGACTTGGCAGAAGGTGGAAGG + Intergenic
923179571 1:231503162-231503184 CAGTCTTGGCAGAAGGTGAAAGG - Intergenic
923757378 1:236804321-236804343 CTGTATCTTCACATGGTGGAAGG - Intronic
923966761 1:239150114-239150136 CCTTATCTGCAAAAAGTGGATGG - Intergenic
924226873 1:241929112-241929134 CTGTACCTGCAAATGGTGGAGGG - Intergenic
924327661 1:242911875-242911897 TTGTATCTGCAGATGGAGGAAGG - Intergenic
924826286 1:247542398-247542420 CAGCATATGGAAAAGGTGGAAGG + Intronic
924955045 1:248917947-248917969 CTGTATCAGGAGAAGGTGGGTGG + Exonic
1063297111 10:4817832-4817854 CAGTCCCTGCTGAAGGTGGATGG + Intronic
1063802285 10:9594057-9594079 CTGTATCTTCACAAGGGGGAAGG + Intergenic
1064668400 10:17682154-17682176 TAGTACTTGCATAAGGTGGAAGG - Intronic
1064909087 10:20380532-20380554 CAGGATCTGCAGGAGGTGCTTGG + Intergenic
1065772207 10:29088051-29088073 CAGTAACAGTAGAAGGTGAAGGG - Intergenic
1066320322 10:34296696-34296718 CAGTACATGCTGATGGTGGATGG + Intronic
1068502846 10:57861988-57862010 CAGTGTCTGGAGAAGGGAGACGG - Intergenic
1070226556 10:74514381-74514403 AAATATCTCCAGAAGGTGAAGGG - Intronic
1071239675 10:83691857-83691879 CTGTCACTGCAGAAGGGGGAGGG - Intergenic
1071937687 10:90549274-90549296 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1072764411 10:98083992-98084014 CTGTCTCTTCAGGAGGTGGAAGG + Intergenic
1072905479 10:99449339-99449361 AAGTCTAGGCAGAAGGTGGAAGG + Intergenic
1073073091 10:100807140-100807162 CAGTGTCTGCAGAAAGTGTTGGG - Intronic
1073245228 10:102085738-102085760 CATTATCCTCAGAAGGAGGAGGG + Intergenic
1074483975 10:113854990-113855012 CAGTATCTGCAGAAGGTGGACGG + Exonic
1074643683 10:115418789-115418811 CAATATATTCAGAATGTGGAAGG + Intronic
1075606787 10:123817397-123817419 CATTATTTGCAGAAGATGGCAGG - Intronic
1075951434 10:126481131-126481153 CAAGATCTGCAGATGATGGAAGG - Intronic
1076822658 10:132947143-132947165 CGGTGTCTGCAGAAGGCAGAGGG - Intergenic
1078040015 11:7851633-7851655 CAGGAACTGCAGAAGGTGCTGGG - Intergenic
1079742951 11:24086521-24086543 CAGTATCTGGAGGGGGAGGAGGG - Intergenic
1081209775 11:40318477-40318499 AAGTATCTGTAGAAGGTAGCAGG - Intronic
1082119137 11:48358919-48358941 CAGTAATGGCAGAAGGTGAAGGG + Intergenic
1082715757 11:56611276-56611298 CAGTATCTGAAAAAGAAGGAAGG - Intergenic
1082999658 11:59279854-59279876 TAGTATCTGCAGAAGATGGCAGG - Intergenic
1083023269 11:59528683-59528705 CAGTATGGGCAGAACATGGAGGG + Intergenic
1083055825 11:59818742-59818764 CAGTTTATGCAGCAGGTGGTAGG + Intergenic
1083471197 11:62885200-62885222 CAGGATCTGCTGAAGGTCGGAGG - Exonic
1084603136 11:70158459-70158481 CTGTATCAGCAGGAGGGGGATGG - Intronic
1084956187 11:72692881-72692903 ATGTATGTGCAGAAGGTGGAGGG + Intronic
1085987006 11:81799939-81799961 CAGTCTTGGCAGAAGGTGAAGGG - Intergenic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1089744593 11:120607867-120607889 GAGCAACTGGAGAAGGTGGAGGG + Intronic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1090449478 11:126793524-126793546 GAGTTCCTGCAGAAGGTGCATGG + Intronic
1091055975 11:132419550-132419572 AAATCTCTGCAGATGGTGGAAGG + Exonic
1091376316 12:26816-26838 CAGTACCTGCAGAAGGTCTCTGG - Intergenic
1092284119 12:7119100-7119122 CAGTACCTGCAGCTGGTGGCTGG + Intergenic
1096876649 12:54634870-54634892 CAGAATCTGCAGAAGGTCTGGGG + Exonic
1098975170 12:76895132-76895154 CTGTATCTGCAAAAGGAGCAAGG + Intergenic
1099033551 12:77559092-77559114 CAGTCACGGCAGAAGGTGAAGGG + Intergenic
1099773116 12:87089440-87089462 CTGTATCTTCACATGGTGGAAGG + Intergenic
1100176730 12:92039054-92039076 GTGTATCTGTAGAAGTTGGAAGG - Intronic
1100640989 12:96482129-96482151 CAGTAGCTGCTGAAGGGGCAAGG + Intergenic
1101384953 12:104248707-104248729 CAGTATCTGCCGTAAGTGGAAGG - Intronic
1101630736 12:106491581-106491603 GAGTATCTGCAGAAAGTAAAAGG + Intronic
1103626895 12:122226526-122226548 CAGCAGCTGCAGCACGTGGACGG + Exonic
1104057280 12:125240113-125240135 CAGAATCACCAGAAGGTGGAAGG - Intronic
1104180969 12:126380399-126380421 CAGACTCTGCCGAAGTTGGATGG + Intergenic
1104722153 12:131050545-131050567 CAGTCATGGCAGAAGGTGGAGGG + Intronic
1105019687 12:132807883-132807905 CAGCATCTGCAGCAGGTGGTGGG - Exonic
1105705737 13:22966467-22966489 CAGCATCTGGAGAAGGCGGAGGG + Intergenic
1105858640 13:24391452-24391474 CAGCATCTGGAGAAGGCGGAGGG + Intergenic
1106374879 13:29176603-29176625 CCATATCTTCAGATGGTGGAAGG + Intronic
1107425690 13:40290360-40290382 TTGTGTCTGCACAAGGTGGAGGG - Intergenic
1109117763 13:58410202-58410224 CAGTATCTTCACAGAGTGGAAGG - Intergenic
1109367162 13:61370387-61370409 GAGTATCTGCAAAAGGCAGAAGG - Intergenic
1109958537 13:69601816-69601838 CAGTCTTGGCAGAAGGTGAAAGG + Intergenic
1110890497 13:80691702-80691724 CAGTATCTTCATAATGTTGATGG - Intergenic
1111738568 13:92173784-92173806 AAATATTTGCAGAATGTGGAAGG + Intronic
1112249931 13:97770305-97770327 AATTATCTGCAGAAGATGGCAGG + Intergenic
1113220242 13:108092544-108092566 CTGTATGAGCAGAAGGGGGATGG - Intergenic
1113319708 13:109221690-109221712 CGTTATCTGCAGAAGATGGCAGG + Intergenic
1113429730 13:110239698-110239720 CTGAATATGCAGAAGGTGGCAGG + Intronic
1113429732 13:110239717-110239739 CAGGAAGTGCAGAAGGTAGAAGG + Intronic
1113507641 13:110828143-110828165 CAGTGTCTGCTGAGGGTGTATGG + Intergenic
1113670902 13:112175475-112175497 CAGAATCTGGAGGAGGAGGAAGG + Intergenic
1115979021 14:39029560-39029582 CAGTCACGGCAGAAGGTGAAGGG + Intergenic
1118740107 14:68733322-68733344 CAGTTACAGCAGAAGCTGGAAGG + Intergenic
1122039978 14:98980284-98980306 CTGTATCTTCACAGGGTGGAAGG - Intergenic
1122905053 14:104797775-104797797 CAGCAGCTGCAGAAGGTGACAGG - Intergenic
1123219532 14:106843145-106843167 CAAAATTTGCAGAAGATGGAAGG - Intergenic
1202884432 14_KI270722v1_random:90942-90964 TAGTACTTGCAGGAGGTGGAAGG - Intergenic
1202884460 14_KI270722v1_random:91366-91388 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1125762730 15:42108303-42108325 CAGTCTCAGCAGAAGGTTAAAGG + Intergenic
1127175550 15:56351534-56351556 CAGTATCTGCATATTGTGTAAGG + Intronic
1127967395 15:63932608-63932630 CAGTAGCTTGAGAAGGAGGAAGG + Intronic
1128895997 15:71374603-71374625 CAGCCTCTGAAGAAGCTGGAGGG - Intronic
1131392127 15:92058203-92058225 TAGCATCTCTAGAAGGTGGAGGG + Intronic
1131933100 15:97467975-97467997 ATGTATCTGCAGGAGGGGGATGG + Intergenic
1132450612 15:101966186-101966208 CAGTACCTGCAGAAGGTCTCTGG + Intergenic
1133594709 16:7280395-7280417 CAGTATCTGCACAATGTCCAAGG + Intronic
1134083160 16:11338425-11338447 CTGTGTCTTCACAAGGTGGAAGG + Intronic
1134169278 16:11955762-11955784 CACTATCTGCAAGAGGTGGGAGG - Intronic
1134284295 16:12846730-12846752 CAGTAATTCCAGAAGATGGAAGG + Intergenic
1136126217 16:28183267-28183289 CAGTTCCTGCAGAAAGTGGAAGG + Intronic
1137486635 16:48896541-48896563 TGGTATCTGCAGGAGCTGGAAGG - Intergenic
1138945383 16:61843009-61843031 CAGGACCTGCTGGAGGTGGATGG + Intronic
1140854709 16:78967881-78967903 CAGTAGCTGCAGGAGGAGGAGGG + Intronic
1141082059 16:81061359-81061381 CCGTTTCTGCAGAAGCTGCAAGG + Exonic
1142323717 16:89400894-89400916 GGGTGTCTGCAGAGGGTGGAGGG - Intronic
1146343340 17:32040890-32040912 CACCACCTGCAGAAGCTGGAGGG + Intronic
1146643296 17:34557117-34557139 CAGTATTTGCAGAAGCTGGGAGG + Intergenic
1147381331 17:40057976-40057998 CACTATGGGCAGCAGGTGGATGG + Intronic
1147817964 17:43223930-43223952 CACTCTCTGCAGAAGTTGGAAGG + Intergenic
1148912083 17:50948282-50948304 CAATATTTGCAGGAGGGGGAAGG - Intergenic
1149128147 17:53260530-53260552 CAATCACTGCAGAAGGTGAAAGG - Intergenic
1149553932 17:57559769-57559791 CAGTGTCTGCAGAAGGGCCAAGG + Intronic
1150671010 17:67197279-67197301 CACAATCAGCAGAAGGTGAAAGG - Intronic
1150782605 17:68135120-68135142 CACCACCTGCAGAAGCTGGAGGG - Intergenic
1152367491 17:79865022-79865044 CAGTAGCTATAGAGGGTGGAGGG - Intergenic
1152615324 17:81335202-81335224 GAGGCTCTGCAGAACGTGGAAGG + Intergenic
1153351362 18:4084024-4084046 AAGTAGCTCCAGAAGATGGATGG + Intronic
1154068461 18:11131068-11131090 AGTTATCTGCAGAAGGTGGCAGG - Intronic
1157998507 18:52588155-52588177 AGTTATCTGCAGAAGATGGAAGG + Intronic
1158635365 18:59151577-59151599 CAGCAGGTGCAGAAGGTGGCAGG - Intronic
1159288738 18:66389773-66389795 CAGCTTCTTCACAAGGTGGAAGG - Intergenic
1160038082 18:75319778-75319800 CAGCAGCTGCAAGAGGTGGAAGG - Intergenic
1160062093 18:75540103-75540125 TTGAATCTGCAGAAGGAGGAAGG + Intergenic
1160634649 19:66361-66383 CAGTACCTGCAGAAGGTCTCTGG - Intergenic
1160966213 19:1748067-1748089 CAGAATCTGCAGACCGGGGATGG - Intergenic
1162883210 19:13676069-13676091 CAGTATCTGCAGACACTGGAAGG - Intergenic
1163435502 19:17292826-17292848 CAGGATCTGCAGAAGACGCAGGG + Exonic
1163756714 19:19110833-19110855 CAGGATCTGCATGAGGTCGAAGG - Exonic
1165426227 19:35746843-35746865 CAGTATGTGCAGAAGTTGTCAGG - Exonic
1166422681 19:42651070-42651092 CTGTATCTGCACATGGTGGAGGG - Intronic
1167116750 19:47493013-47493035 AAGTGTCTGCTGAAGGTGGCTGG - Exonic
1202633613 1_KI270706v1_random:22741-22763 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1202652273 1_KI270707v1_random:17318-17340 CTGTCTCTGTAGAAGTTGGATGG - Intergenic
1202659840 1_KI270708v1_random:58071-58093 TAGTACTTGCAGGAGGTGGAAGG - Intergenic
1202659868 1_KI270708v1_random:58412-58434 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
926810399 2:16750706-16750728 TAGTATCTGCAGAAGATGGCAGG + Intergenic
929070943 2:38029881-38029903 CAATCACGGCAGAAGGTGGAAGG + Intronic
929187470 2:39110347-39110369 AAGTATCTGCGGGAGGAGGATGG - Intronic
929376977 2:41299298-41299320 GTGTATGTGCAGGAGGTGGAGGG - Intergenic
931164662 2:59733563-59733585 CAGTCCCAGCAGAAAGTGGACGG + Intergenic
932577015 2:72968316-72968338 CAGTTTGTGTAGAGGGTGGAAGG - Intronic
933314651 2:80701686-80701708 CAACATCTGCAGAAGGTACAAGG - Intergenic
935406171 2:102711922-102711944 CAGTATGTGCAGAGGTTGTATGG + Intergenic
935735183 2:106100817-106100839 CAGGCCCTTCAGAAGGTGGAGGG + Intronic
936566828 2:113588666-113588688 CAGTACCTGCAGAAGGTCTCTGG + Intergenic
937243532 2:120477640-120477662 CAGTATGTTCAGAAGGAGGCTGG - Intergenic
939091005 2:137780211-137780233 CAGTATCTGGGTAAGATGGAAGG - Intergenic
939269266 2:139916692-139916714 CTGTATCTTCACATGGTGGAAGG - Intergenic
940124252 2:150306688-150306710 CAGTATCTGGAGAAGGAGATAGG - Intergenic
940164766 2:150758349-150758371 CAGTTTCTTCAGAAGGAGAAAGG + Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942351016 2:175052952-175052974 CAGTATCTCCACACTGTGGAGGG - Intergenic
942565526 2:177262351-177262373 CAGTATCTCCATTAGGTGGAAGG - Intronic
943571995 2:189584508-189584530 CAGCATCTGGAGAACGTGAAGGG - Intergenic
944315244 2:198277733-198277755 CAGGATCTGGAGCAGGAGGAGGG - Intronic
946149366 2:217753769-217753791 CAGTAACTGGAGAAGGGGGCAGG + Intronic
947100705 2:226618265-226618287 CAGTGTCTGCAGATGTTGAAAGG - Intergenic
947361688 2:229351792-229351814 CAGAATCTGCATATGGTGGAAGG + Intergenic
947406304 2:229781103-229781125 GAGCCTCTGCAGAAGGTGGAAGG + Intronic
1169394091 20:5214499-5214521 CAGGATTTCCAGAAGGTGCATGG + Intergenic
1169837933 20:9901189-9901211 CTGTATCTTCACATGGTGGAAGG + Intergenic
1170473153 20:16688325-16688347 AAGAATCTGCAGAAGGTGAGAGG + Intergenic
1172205425 20:33159863-33159885 CAGGAGCTGCAGGAGGTGGTGGG + Intergenic
1173240021 20:41286924-41286946 CACTATCTTCACAAGGTGGCAGG - Intronic
1173495718 20:43515754-43515776 CTCTAGCTGCAGAAGCTGGAAGG + Intronic
1174250936 20:49219175-49219197 CAGTATTTGAGGAGGGTGGAAGG - Intergenic
1174368928 20:50073306-50073328 CAGCTTCTGAAGAAGGTGGGTGG + Intergenic
1175434255 20:58931534-58931556 CTGTATCTGTACATGGTGGAAGG - Intergenic
1176599878 21:8782337-8782359 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1176645827 21:9348598-9348620 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1177505564 21:22014211-22014233 AGTTATCTGCAGAAGATGGAAGG + Intergenic
1178441564 21:32602667-32602689 CTGGATCTACATAAGGTGGAGGG + Intronic
1178671232 21:34593516-34593538 CAGTAAATGCAAAAGGTGGCAGG - Intronic
1180327314 22:11441633-11441655 TAGTACTTGCAGGAGGTGGAAGG - Intergenic
1180327343 22:11441974-11441996 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1180367101 22:11950555-11950577 CTGTCTCTGTAGAAGTTGGATGG - Intergenic
1181683744 22:24514479-24514501 CAGGATCAGGAGGAGGTGGAAGG + Intronic
1182392173 22:30007585-30007607 CAGTATCTGCAGACCATGGCAGG + Intronic
1183096102 22:35553212-35553234 CTGTGTGTGCAGAAGGTGGTGGG - Exonic
1184039357 22:41933923-41933945 CACTGTCTGTAGAGGGTGGAAGG + Intergenic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
1184358398 22:43997714-43997736 CATTACCTGCAGAAGCTGCAGGG + Intronic
1184940632 22:47762178-47762200 AAGTCTCTGCAGAAGGAGGTTGG - Intergenic
949245863 3:1924893-1924915 AGTTATCTGCAGAAGGTGGCGGG - Intergenic
949991256 3:9581101-9581123 GAAAATCTGCAAAAGGTGGATGG + Intergenic
950375508 3:12568945-12568967 TAGTACTTGCAGATGGTGGACGG - Exonic
950427370 3:12931736-12931758 CAGTAGCTCCAGCAGGTGGATGG + Intronic
950518511 3:13482477-13482499 TAATATCATCAGAAGGTGGAGGG + Intronic
950634909 3:14307828-14307850 CAGTATGTGCTGGAGGAGGAGGG - Intergenic
951246683 3:20349575-20349597 CAATACATGCAGAAGCTGGATGG + Intergenic
952945580 3:38476311-38476333 CACTTCCTGCAGCAGGTGGAAGG + Intronic
954899073 3:54003474-54003496 CAGGATCTGTTGCAGGTGGAGGG - Intergenic
956300139 3:67763514-67763536 CAGTATCTTCATAATGTCGATGG + Intergenic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956444302 3:69310448-69310470 AATTATCTGCAGAAAGTGGAAGG + Intronic
956525564 3:70155788-70155810 CAGTTTCTGCTTAGGGTGGAGGG + Intergenic
956907039 3:73777231-73777253 CAGATTATGCAGAAGGTGGTTGG + Intergenic
957211243 3:77261285-77261307 AAGTGTCTGCAGAACCTGGAAGG - Intronic
957385049 3:79485661-79485683 CTGTATCTGCAAAATGGGGATGG - Intronic
959997856 3:112698292-112698314 AGTTATCTGCAGAAGATGGAAGG - Intergenic
960438289 3:117654445-117654467 TTGTGTGTGCAGAAGGTGGAGGG - Intergenic
960972669 3:123150706-123150728 CAGTGTCTGGAGAAGGAAGAGGG - Intronic
961268781 3:125671823-125671845 CAGCAGCTGCAGAGGGTGCATGG + Intergenic
962013579 3:131418240-131418262 CTGTATCTGTAGAATGAGGAAGG - Intergenic
962384828 3:134924114-134924136 TAATTTCTGCATAAGGTGGAAGG - Intronic
963661389 3:148132115-148132137 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
966683385 3:182667433-182667455 CAGTAGCGGCAGTAGGTGGAGGG - Intergenic
967519294 3:190410235-190410257 AAGTGTGTGCATAAGGTGGAAGG - Exonic
967932359 3:194699489-194699511 CAGACTCTGCAACAGGTGGAGGG + Intergenic
967992230 3:195139886-195139908 CAGAATCTCCAGAAGCTGGGAGG - Intronic
968012788 3:195297381-195297403 AAGCATCTGCAGAATGTGTAAGG - Intronic
1202741058 3_GL000221v1_random:56465-56487 CTGTCTCTGTAGAAGTTGGATGG - Intergenic
969402420 4:6964345-6964367 CAGGAGCTGCAGAGGGTGTAAGG - Intronic
969449088 4:7262838-7262860 CTGTGTCTGGTGAAGGTGGAGGG + Intronic
969745390 4:9066896-9066918 AAGTTTTTGCTGAAGGTGGATGG - Intergenic
971035605 4:22689608-22689630 CAGTACCTTCAGAAGGTGGCAGG + Intergenic
972000586 4:34027554-34027576 CAGTCTTCGCAGAAGGTGAATGG - Intergenic
974216031 4:58848781-58848803 CACCCTGTGCAGAAGGTGGAAGG - Intergenic
975096473 4:70462859-70462881 CAGGAACTGCAGCAGGAGGATGG + Intronic
976378964 4:84377880-84377902 CAGTATCTTCATAAGGTAGTGGG + Intergenic
977430763 4:96928182-96928204 AGGTATCTGCAGAAGATGGCAGG - Intergenic
978420412 4:108526764-108526786 GAATATGTGGAGAAGGTGGAAGG - Intergenic
978966848 4:114750914-114750936 AATTATCTGCAGAAGATGGCAGG - Intergenic
982397790 4:154930779-154930801 CTGTATCTGAAGCAGGTTGAAGG + Intergenic
982734492 4:158991375-158991397 CAGTATTTGCAAAAAGTGCAAGG + Intronic
984103318 4:175513977-175513999 CAGTCACAGCAGAAGGTGAAGGG - Intergenic
985190743 4:187369930-187369952 CAGGATCTGTAGAAGGTCTAAGG + Intergenic
985263492 4:188136852-188136874 CAGCATCTGTAGAAGGTAGTTGG + Intergenic
985583716 5:715009-715031 CACTAACAGCAGAAGGTGAAGGG - Intronic
985597224 5:799306-799328 CACTAACAGCAGAAGGTGAAGGG - Intronic
985725898 5:1515590-1515612 CAGTATCTGTAGATAGTGCAGGG - Intronic
986003700 5:3650050-3650072 CAGCTTCTTCACAAGGTGGAAGG - Intergenic
986006622 5:3673693-3673715 CAGTATTTGCAGGTGGTGGTAGG - Intergenic
986071704 5:4291360-4291382 CAGTATCTTCTAAAAGTGGATGG + Intergenic
986210347 5:5665688-5665710 GAGGAGCTGCAGGAGGTGGAGGG + Intergenic
986785734 5:11112360-11112382 CCGGATCTGAAGATGGTGGAAGG + Intronic
988521667 5:31951015-31951037 CTGTACCTGCACATGGTGGAAGG + Intronic
988562127 5:32290818-32290840 CGTTATCTGCAGAAGATGGCAGG - Intronic
989819324 5:45776250-45776272 GGGAATCTCCAGAAGGTGGAGGG - Intergenic
991932657 5:71769150-71769172 CAGTATCTACAGAATTTGGAGGG + Intergenic
992533112 5:77671402-77671424 CAGAATCTGGAGGGGGTGGAGGG + Intergenic
994662253 5:102668058-102668080 CAGTATCTGATAAAGGTGTAAGG - Intergenic
995368344 5:111389176-111389198 CTGTGTCTGCACATGGTGGAAGG + Intronic
996018556 5:118567827-118567849 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
996825560 5:127677806-127677828 AATTATCTGCAGAAGATGGCAGG - Intergenic
997100196 5:130959642-130959664 CAGTCACGGTAGAAGGTGGAAGG - Intergenic
997242043 5:132314854-132314876 CAGTGTCTGCAGAGGGGAGAAGG + Intronic
997620849 5:135292717-135292739 CAATATCTGCAGAAGGCAGATGG + Intronic
997679360 5:135738451-135738473 CATTTGCTGCAGAAGGTGGAGGG + Intergenic
998771697 5:145553000-145553022 AAATATCTGCAAAAGGTAGAAGG - Intronic
1000223249 5:159234277-159234299 AGGTATCTGCAGAAGATGGCAGG + Intergenic
1000970728 5:167711436-167711458 GACTAGCTGCAGAATGTGGAAGG - Intronic
1002805684 6:571996-572018 GTGTGACTGCAGAAGGTGGACGG + Intronic
1003644519 6:7903749-7903771 CTGTTTCTGAAGGAGGTGGAGGG - Intronic
1005033153 6:21530163-21530185 CATTTTCTGCAGGAGCTGGAAGG - Intergenic
1005033921 6:21537823-21537845 CAGCAGCTGCAGCAGTTGGAGGG - Intergenic
1005521217 6:26602213-26602235 CAATAACTGCTGAAGGTGGCTGG - Intergenic
1006561262 6:34914721-34914743 CAGTTTCTGCAGAACTTAGAAGG + Intronic
1006865120 6:37203237-37203259 CAGAAGTTGGAGAAGGTGGATGG + Intergenic
1008369232 6:50714441-50714463 CAGTAGATGCACAAGGGGGATGG + Intronic
1008863524 6:56181187-56181209 TAGTATCCTCAGAAGGTGTAAGG + Intronic
1008868032 6:56238657-56238679 AGGTATCTGCTGAAGGTGGCAGG - Intronic
1009052431 6:58292514-58292536 CAGTCATGGCAGAAGGTGGAGGG + Intergenic
1009238679 6:61158100-61158122 CAGTCATGGCAGAAGGTGGAGGG - Intergenic
1010676892 6:78755778-78755800 CAGTCTTGGCAGAAGGTGAAGGG - Intergenic
1011334927 6:86249971-86249993 CAGTTATGGCAGAAGGTGGAGGG - Intergenic
1011733521 6:90290760-90290782 AAGTATCTGCAGAAAGTGACAGG + Intronic
1011754737 6:90486919-90486941 CAATCTCTCCAGAAGCTGGAAGG - Intergenic
1012108574 6:95197765-95197787 AGTTATCTGCAGAAGGTGGGAGG + Intergenic
1013870443 6:114752220-114752242 AAGTATCTGAAAAGGGTGGATGG + Intergenic
1014641181 6:123912673-123912695 CACTAACAGCAGAAGGTGAAGGG - Intronic
1015211936 6:130708564-130708586 CACTCATTGCAGAAGGTGGAGGG + Intergenic
1016527693 6:145021167-145021189 GAGCATCTGCAGAAAGTGGAGGG - Intergenic
1016540382 6:145157872-145157894 CTGTATCCTCACAAGGTGGAAGG - Intergenic
1018133960 6:160760415-160760437 CAATATTGGCAGAAGGTGAAGGG + Intergenic
1018547353 6:164952345-164952367 CAGAAGTGGCAGAAGGTGGAAGG - Intergenic
1021170398 7:17392263-17392285 CAGTCACAGCAGAAGGTGAAGGG + Intergenic
1022062091 7:26807449-26807471 CAGCTTCTTCACAAGGTGGAAGG - Intronic
1022320413 7:29282941-29282963 CAATATCAGCAGGTGGTGGATGG + Intronic
1022955967 7:35380652-35380674 CTCCATCTTCAGAAGGTGGAGGG - Intergenic
1024295993 7:47842748-47842770 GAGCAGCTGCAGAAGGTGAAGGG + Intronic
1028935010 7:96455034-96455056 AATTATCTGCAGAAGATGGCAGG - Intergenic
1029308665 7:99641037-99641059 CAGTCTCTTCAGAAGGTGGTAGG + Intergenic
1030656051 7:112169188-112169210 CAGTCACAGCAGAAGGTGAAGGG - Intronic
1030713032 7:112775170-112775192 CTGTACCTGCAGAAGTTGGTGGG + Exonic
1032513884 7:132492999-132493021 CAGTACCTGAAGCAGGGGGAGGG + Intronic
1032636394 7:133713801-133713823 CAGTCACGGCAGAAGGTGAAGGG - Intronic
1032782642 7:135176480-135176502 CAGAAGCTTCAGAAGTTGGAAGG + Intergenic
1034852060 7:154502576-154502598 CAGTCACAGCAGAAGGTGAAAGG - Intronic
1035731196 8:1854515-1854537 CAGTGTTTGCAGAGGATGGAGGG + Intronic
1036062781 8:5342744-5342766 CTGTGTCTGCAGAATATGGAGGG + Intergenic
1038083434 8:24166041-24166063 CAGTTTTTCCTGAAGGTGGAGGG + Intergenic
1038115426 8:24548606-24548628 CAGTATCTGCAGAAAGAATAAGG - Intergenic
1039479278 8:37859790-37859812 CAGCATCTGCAGCAGCTGGAAGG + Exonic
1039597234 8:38801381-38801403 CAGTTTCTGCATATGGTGTAAGG + Intronic
1040551489 8:48440892-48440914 CTGTATGTGCAGAATGTGGACGG - Intergenic
1043158381 8:76815446-76815468 CAGTATCCTCACATGGTGGAAGG + Intronic
1044441650 8:92230922-92230944 CAGCATCTGCGGAGGGTGCACGG + Intergenic
1044938020 8:97311820-97311842 CAGTGTCTGCAGAAGGAGAAAGG - Intergenic
1045321102 8:101081743-101081765 CAGTATAGGAAGATGGTGGAAGG + Intergenic
1045885600 8:107094061-107094083 CAGTAGCTGCCGGAGGTGAAGGG - Intergenic
1048517547 8:135124494-135124516 CAGTGTATGCAAAAGCTGGAAGG + Intergenic
1048626159 8:136187667-136187689 CTGTATCTGCAAAAGGTGGCAGG + Intergenic
1048785123 8:138042251-138042273 CAATATCTGCTGAAGGTGTAAGG - Intergenic
1048890574 8:138942921-138942943 CCGTATCTACACAAGATGGAAGG - Intergenic
1048898480 8:139015996-139016018 CAGTAGCTATAGAAGGTGCAAGG + Intergenic
1049773242 8:144393360-144393382 CAGGATCTGCAGGGGATGGAAGG + Exonic
1049885703 9:24866-24888 CAGTACCTGCAGAAGGTCTCTGG - Intergenic
1051715299 9:19976480-19976502 CAGTCACAGTAGAAGGTGGAGGG - Intergenic
1052138701 9:24949456-24949478 CAGTACATGCAGAAAGTGGGAGG + Intergenic
1053315874 9:37051506-37051528 CAGTATCAGCTGCAAGTGGAGGG + Intergenic
1053320857 9:37097810-37097832 CAGAATCAGCAGAGGGTGGAGGG + Intergenic
1053390924 9:37735535-37735557 CTGTAACTGCAGAGGGTGGAAGG - Exonic
1055058046 9:72041527-72041549 CTGTCTTTGCAGACGGTGGAAGG + Intergenic
1055928835 9:81539013-81539035 CTGAATCAGCAGAAGGTGGGAGG + Intergenic
1056488508 9:87082885-87082907 CAGAATTTCCAGAAGGTGAATGG - Intergenic
1057137785 9:92706043-92706065 CTGTAACTTCAGATGGTGGAAGG + Intergenic
1057906232 9:98985714-98985736 AAGTCCCTGAAGAAGGTGGATGG - Exonic
1059685159 9:116628098-116628120 CAATATCTGCTAAAGGTGGGTGG - Intronic
1061282988 9:129608072-129608094 CGGTATCCGCACAAGGAGGAAGG + Intergenic
1061767744 9:132892530-132892552 GAGTATCCGCAGGAGGTGGGCGG + Exonic
1203709697 Un_KI270742v1:86395-86417 CTGTCTCTGTAGAAGTTGGATGG - Intergenic
1187584076 X:20640527-20640549 CAGTCACAGCAGAAGGTGAAGGG + Intergenic
1188986167 X:36770202-36770224 TAGGACCTGCAGAAGGTAGATGG - Intergenic
1190278309 X:48913344-48913366 AAGAATCTGCAAAAGTTGGAGGG + Exonic
1190952873 X:55163051-55163073 CATTCTCTGAGGAAGGTGGAGGG + Intronic
1193886466 X:86988049-86988071 CAGTCATGGCAGAAGGTGGAGGG + Intergenic
1193957280 X:87878178-87878200 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
1194228969 X:91298630-91298652 CAGTTTCTTCAGAATGTCGATGG + Intergenic
1194443546 X:93961071-93961093 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1194624982 X:96216575-96216597 CAGTTTCTTCAGAGTGTGGATGG - Intergenic
1197712639 X:129682824-129682846 CTGTATCCTCACAAGGTGGAAGG + Intergenic
1197822798 X:130558571-130558593 CAGTTTCAGTAGAAGGTGTATGG - Intergenic
1199137546 X:144270889-144270911 CAGTCATGGCAGAAGGTGGAGGG + Intergenic
1199537340 X:148917637-148917659 CAGTAGTTGGAGAAGTTGGATGG + Intronic
1199665200 X:150090944-150090966 GAGAATGTGGAGAAGGTGGATGG + Intergenic
1200129252 X:153831974-153831996 CGGTCTCTGCAGCTGGTGGATGG + Intergenic
1200983766 Y:9285667-9285689 CAGCACCTCCAGAAGGTGGTGGG + Intergenic
1201225074 Y:11810788-11810810 TTGTATCTGCAGATGGAGGAAGG - Intergenic
1201389039 Y:13477352-13477374 CATTCTTTGGAGAAGGTGGAAGG - Intronic