ID: 1074485470

View in Genome Browser
Species Human (GRCh38)
Location 10:113873185-113873207
Sequence TAACCTTGATTGATTCTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 161}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074485470 Original CRISPR TAACCTTGATTGATTCTTGA AGG (reversed) Intronic
903030464 1:20460405-20460427 TAACATTGATTTATTCTTTAGGG - Intergenic
903841983 1:26249533-26249555 TTACCTTGAAAGATTCTCGAGGG + Intronic
906881537 1:49596522-49596544 TAATCTTGAGAGATTCTTGGAGG - Intronic
911596732 1:99806291-99806313 TAACCTAGAGTGATTATTTATGG - Intergenic
919361063 1:196595576-196595598 TAATCTAGATTTATACTTGATGG - Intronic
920676257 1:208040509-208040531 TAACCTTGAGTGTTTTTGGAGGG - Intronic
921496278 1:215845759-215845781 TGAAATTGATTGATTCTTGCCGG - Intronic
923137799 1:231133727-231133749 TAACCTTGATTATTTCCTTAGGG - Intergenic
1065507072 10:26439246-26439268 GAACCTGGAGGGATTCTTGAGGG + Intronic
1065552627 10:26884557-26884579 TAATCTTGACCGATTCATGATGG + Intergenic
1065600417 10:27362259-27362281 TAATCTTGACCGATTCATGATGG - Intergenic
1069133836 10:64739602-64739624 TGAACTTCATTGACTCTTGAGGG + Intergenic
1070526669 10:77301481-77301503 TAAACTTGATGGACTTTTGAAGG + Intronic
1071453206 10:85819497-85819519 TAACCTTGATTGCCTGTTTAAGG - Intronic
1071907308 10:90188196-90188218 TAACATTAATTTATTCATGAGGG - Intergenic
1073598320 10:104821952-104821974 TAACCTTGAATGAAACTTCAAGG + Intronic
1074485470 10:113873185-113873207 TAACCTTGATTGATTCTTGAAGG - Intronic
1075499934 10:122964283-122964305 TAACATTAATTCATTCATGAGGG - Intronic
1078884441 11:15486008-15486030 TCACCTTCATTGATTCCTGCAGG + Intergenic
1079830545 11:25262338-25262360 TAACACTGATTGGGTCTTGAAGG + Intergenic
1080074975 11:28138472-28138494 TAACCTTGATTGAGGCTTGTTGG - Intronic
1085942664 11:81223436-81223458 TAACAATGCTTGCTTCTTGAGGG + Intergenic
1086318940 11:85624538-85624560 TAACCTAGATTTATTCTGCAGGG - Intronic
1087810499 11:102605032-102605054 TAACCCTAATTACTTCTTGAAGG - Intronic
1088349331 11:108867004-108867026 TCATCTTGATTGATGCTTCAGGG - Intronic
1088381748 11:109200676-109200698 TAACCTCTATTTATTCTTTAAGG + Intergenic
1088498606 11:110458927-110458949 TAACCTTGATTGTTGATGGATGG + Intronic
1091835135 12:3580420-3580442 TAACCTTCAATGATTCCTTATGG - Intronic
1092998265 12:13971596-13971618 AGACCTTGATTGATTGGTGAGGG - Intronic
1093934302 12:24984607-24984629 TGACATTGATTCATTCATGAAGG + Intergenic
1096353488 12:50919211-50919233 TAACCTTAATTGAGGCTTGTTGG + Intergenic
1100511351 12:95277561-95277583 TAACCTTGCTTTATTCTTTAAGG + Intronic
1103266511 12:119635195-119635217 TAACCTTGCTTGAGTCCTCAAGG - Intronic
1103807878 12:123588122-123588144 AAACCCTGATTGGTTCTTGGTGG + Intronic
1104273256 12:127301784-127301806 TAAGCTTGTGTCATTCTTGAGGG - Intergenic
1105442606 13:20427950-20427972 TCATCTTGATTGAGTTTTGATGG - Intronic
1105553089 13:21416833-21416855 TAATCTTCATTGCTTCTTCATGG - Intronic
1109679845 13:65736446-65736468 TTACCAAGATTGAATCTTGAGGG + Intergenic
1111525225 13:89459662-89459684 TAACCTGAACTAATTCTTGAAGG - Intergenic
1111826927 13:93279535-93279557 TAACATTGATTGCCTTTTGAGGG + Intronic
1111936677 13:94564989-94565011 TAACCTTGAATGATTTTTCTAGG - Intergenic
1112307595 13:98289242-98289264 TAACATTAATTGTTTCTTTAAGG - Intronic
1113282700 13:108807567-108807589 TCTCCTTGATTGAGTCTTGATGG + Intronic
1115317669 14:32042396-32042418 TAACCTTTATTGATTAATAAAGG - Intergenic
1117475382 14:56089226-56089248 TAGCCTTTATTTATTCATGATGG + Intergenic
1117906227 14:60591378-60591400 TAACTTTGATTAATTGTTGTAGG - Intergenic
1117998039 14:61496557-61496579 TAACCTAGATGGAATCTGGAGGG - Intronic
1118999578 14:70870132-70870154 TAACCTTAATTGAAGCTTGTTGG - Intergenic
1119761461 14:77154942-77154964 TAACACTGATTGAGTCTTGCAGG + Intronic
1124049725 15:26185873-26185895 CAACCTTCATTGGTTTTTGATGG + Intergenic
1124545130 15:30619657-30619679 TAACCTTAATTTATTACTGAAGG + Intergenic
1124778655 15:32609052-32609074 TAACCTTAATTTATTACTGAAGG + Intergenic
1125648395 15:41292748-41292770 TAACCCTGATTCATTGTTGGAGG + Intergenic
1130295356 15:82643832-82643854 TAACCTTTATTAATTCTTCCTGG + Intronic
1131909524 15:97182080-97182102 TAAACTTCATTGGTTTTTGAAGG - Intergenic
1132290331 15:100696280-100696302 GAACTTTGATTGGTTCCTGATGG - Intergenic
1134392215 16:13830529-13830551 AAACCTGAAATGATTCTTGAGGG - Intergenic
1135587291 16:23680627-23680649 TTAACTTGCTTGATCCTTGAAGG + Intronic
1138976886 16:62218402-62218424 TAGCCTTGATTGATTATTTTTGG - Intergenic
1142531890 17:585018-585040 ATCCCTTGATTGATTCCTGACGG - Intronic
1145354207 17:22123640-22123662 TAACTTCGTTGGATTCTTGAAGG - Intergenic
1146114254 17:30120316-30120338 TAACCTTGATTCATTTCTTATGG - Intronic
1150026366 17:61678933-61678955 TAACCTTTATGAATTCTTGGTGG - Intergenic
1150421006 17:65035666-65035688 TAACCTTGAGGGATTTTTCAAGG - Intronic
1151529984 17:74698087-74698109 TTTCCTGGATTGACTCTTGATGG - Intronic
1152560479 17:81076164-81076186 TAACAGGGATTGATTCTGGAAGG - Intronic
1158061084 18:53343449-53343471 TTACATTGATTGATTTTTGAAGG + Intronic
1163026308 19:14514678-14514700 TCACCTTGATTGAATTTGGAAGG + Intergenic
1164410109 19:27995579-27995601 TAACATTGATTCAATCTGGAAGG - Intergenic
1165198405 19:34125200-34125222 TTCCCTGGATTGATTGTTGAGGG - Intergenic
929612581 2:43282523-43282545 TGACCATGTCTGATTCTTGAGGG + Intronic
930174326 2:48286204-48286226 GAACCTGGATTGAATCCTGAAGG - Intergenic
931592940 2:63905829-63905851 TTACCTTCATTGATTTTTTAAGG - Intronic
932373399 2:71212340-71212362 TAACCTTGGAAGTTTCTTGAGGG + Intronic
933112436 2:78420676-78420698 TAACCTTAATTATTTCCTGAAGG + Intergenic
933921046 2:87045792-87045814 TAACAATTATTGATTCTTGATGG - Intergenic
933930585 2:87148004-87148026 TAACAATTATTGATTCTTGATGG + Intergenic
934001920 2:87723793-87723815 TAACAATTATTGATTCTTGATGG + Intergenic
934678042 2:96263877-96263899 TAAGCTTGAGTGAGTCTTGGTGG - Intronic
935819412 2:106879019-106879041 GAACCTTGGTTGTTTCTAGATGG - Intronic
936362541 2:111817448-111817470 TAACAATTATTGATTCTTGATGG - Intronic
937558523 2:123191019-123191041 CAACCTTAATTGATTCTGGATGG - Intergenic
942561785 2:177227603-177227625 TAACATTGACTGATATTTGAAGG - Intronic
942620275 2:177837766-177837788 TAACCTTAATTGAGGCTTGTTGG + Intronic
943348045 2:186763557-186763579 TAAGCTTGCTTCATTGTTGAGGG - Exonic
1168731723 20:88519-88541 TAACATTGATTGATTCTGAAGGG - Intronic
1171080548 20:22178272-22178294 TAATCTTTATAGCTTCTTGATGG - Intergenic
1171886529 20:30656528-30656550 TAACATAGATTGATACCTGAAGG + Intergenic
1174292639 20:49519794-49519816 AAACCTGGATTCATCCTTGATGG + Intronic
1175010172 20:55726876-55726898 CAACCTTGACTGAGACTTGAAGG - Intergenic
1182409915 22:30175742-30175764 AAACCTTAATTGCTTCTTGTTGG + Intronic
949418332 3:3837222-3837244 TAACCTTGCTTGATACTGCATGG - Intronic
949917934 3:8979324-8979346 TGACATTAATTGATTCATGAGGG - Intergenic
951034751 3:17920842-17920864 TAAATTTGATGGTTTCTTGAGGG + Intronic
957716130 3:83931206-83931228 TAACCTTAATTGAGGCTTGTTGG + Intergenic
958956264 3:100468462-100468484 TAACCTTAATTGAAGCTTGTTGG + Intergenic
962006060 3:131351319-131351341 TAGGCTGGATTGTTTCTTGAAGG - Intergenic
963093186 3:141506249-141506271 TGATCTTGATTTATTGTTGAAGG + Intronic
963746265 3:149127803-149127825 TAACCTTAATTATTTCTTAAAGG - Intergenic
965011947 3:163105514-163105536 TAACCATGAATGGTGCTTGAAGG + Intergenic
968381087 4:96452-96474 TAACCTTAATTGGTGCTTGTTGG + Intergenic
970005244 4:11404665-11404687 TTACCTGGTTTGTTTCTTGAGGG - Intronic
970368235 4:15382802-15382824 TAACCTTAGTTGATTCTTCCTGG + Intronic
971975723 4:33683890-33683912 ACAGCTTGATTTATTCTTGAGGG + Intergenic
973346467 4:49061138-49061160 TAACCTTGATTACTTCCTTAGGG + Intronic
977215476 4:94278285-94278307 GAAACTTGATTCATTCTAGATGG - Intronic
977879960 4:102192706-102192728 TTACCTTGAGTGTTTGTTGAAGG + Intergenic
978090887 4:104713202-104713224 TGACCTTGTTTGGTTCTTGGAGG + Intergenic
979748977 4:124252597-124252619 TAAGCTTGATTTATTGCTGATGG - Intergenic
979947893 4:126857216-126857238 TAACCATGATTACTTCTTTAAGG - Intergenic
980546875 4:134275670-134275692 TAACCTCGATTTAATTTTGAAGG + Intergenic
982977776 4:162089011-162089033 TAACATTGATCTATTCATGAGGG - Intronic
983912445 4:173255235-173255257 TACCCTTGATAGGTTCTAGATGG + Intronic
986000402 5:3626749-3626771 TGACCTTGATGTGTTCTTGAGGG - Intergenic
986205064 5:5616351-5616373 TAACCTTAATTAATTTTTAAAGG + Intergenic
989129197 5:38088208-38088230 TTACATTGATTGACTTTTGAAGG - Intergenic
990996781 5:61740297-61740319 TATCTTTGATAGACTCTTGAAGG - Intronic
992515286 5:77485526-77485548 TAACCTTGTCTGTTTCCTGAAGG + Intronic
992765990 5:80000659-80000681 TAACCTTGAATGAAAGTTGAAGG - Intronic
994008617 5:94873075-94873097 TAAATTTGATTTATTTTTGAGGG - Intronic
995038957 5:107566900-107566922 TAATCTTGACTAATCCTTGAAGG + Intronic
995265108 5:110151085-110151107 AACCCTTGATGGGTTCTTGATGG + Intergenic
997176768 5:131786676-131786698 TGACCTTAATTCATTCATGAGGG - Intronic
998952819 5:147409047-147409069 TGACCTGGTATGATTCTTGAAGG - Intronic
1000707788 5:164533099-164533121 TAACCTTAATTGATGCTCTAAGG - Intergenic
1001911067 5:175518191-175518213 TAAACTTGGGTCATTCTTGATGG + Intronic
1007329715 6:41096210-41096232 AAACCTAGTTTGATTGTTGAGGG - Intronic
1008396679 6:51016965-51016987 TAACCTTATCTGCTTCTTGAGGG + Intergenic
1008638816 6:53440204-53440226 TACACTTGATTGCTTCTAGAAGG - Intergenic
1008850890 6:56019997-56020019 TTACATTGGTTGATTGTTGAAGG - Intergenic
1010541372 6:77095854-77095876 TAACCTTAATTGAGGCTTGTTGG + Intergenic
1010872864 6:81063519-81063541 TAACCTTAATTGAAGCTTGTTGG - Intergenic
1012102155 6:95103985-95104007 TAACATTGTTCGTTTCTTGATGG - Intergenic
1013875925 6:114828178-114828200 TATCCCTGATTGATTTTTCATGG + Intergenic
1015105743 6:129533958-129533980 TAACCATAATTGGTTGTTGATGG + Intergenic
1017574373 6:155786020-155786042 TGACATTAATTCATTCTTGAGGG - Intergenic
1018645941 6:165948636-165948658 TCACCTCGATGGTTTCTTGATGG - Intronic
1020339812 7:7097895-7097917 TAACCTTGATTTATACGTGTAGG + Intergenic
1020468491 7:8508280-8508302 AAACTTTGATTGATTGTTAAGGG + Intronic
1020568933 7:9832567-9832589 TAAACTTCATAGAATCTTGATGG + Intergenic
1022807273 7:33835039-33835061 TAACCTTGATTCAAGCTTGAGGG + Intergenic
1023263378 7:38380293-38380315 TCAGGTTGTTTGATTCTTGAGGG - Intergenic
1024525042 7:50341047-50341069 TAACCATGTTTTATTATTGATGG + Intronic
1024774436 7:52766016-52766038 TATCCTTGATTAATTCCTTAGGG - Intergenic
1027211583 7:76153366-76153388 TAACATTAATTCATTCATGAGGG + Intergenic
1029339533 7:99931862-99931884 GAAACTGGATTCATTCTTGAGGG - Intergenic
1032681008 7:134183461-134183483 TAACATTTATTGGTTCTTGATGG - Intronic
1032738962 7:134719779-134719801 TTACCTTGGTTGAGTCTTAAGGG + Intergenic
1036002725 8:4626023-4626045 CAACCTTGATATATTTTTGATGG + Intronic
1038033712 8:23667901-23667923 TAAGCTTCATTGATTCATCAAGG + Intergenic
1039015314 8:33141631-33141653 TAACATTGCTTTATTCTTGGTGG + Intergenic
1039259963 8:35760845-35760867 AAACCTTGATTGCATCATGATGG + Intronic
1040404924 8:47090980-47091002 AAAATTTGAATGATTCTTGAGGG - Intergenic
1040828138 8:51646125-51646147 TAACATTAATTCCTTCTTGAGGG - Intronic
1041385983 8:57303317-57303339 AAAGTTTGATTGATTTTTGATGG + Intergenic
1044326245 8:90861734-90861756 TAACCTTAATTTCTACTTGAGGG + Intronic
1047044198 8:121033591-121033613 GAAGCTTGATGGAATCTTGAGGG + Intergenic
1047269955 8:123347589-123347611 AAAAGTTGATTGATTGTTGATGG - Intronic
1047326087 8:123837242-123837264 TAAGCCTGACTGATTTTTGAGGG + Intergenic
1048237642 8:132707487-132707509 TAACATTAATTCATTCATGAGGG - Intronic
1051193678 9:14539833-14539855 TAACCTTGATGAAATATTGAAGG - Intergenic
1052404827 9:28046282-28046304 TAACCTAGATAAATTCTTAATGG - Intronic
1052908839 9:33861726-33861748 TAAACTTGAATGTTTTTTGATGG + Intronic
1055592725 9:77834571-77834593 TAAACCTGATTGATTTTAGAAGG + Intronic
1058479669 9:105378902-105378924 TCAACTTGAATGAATCTTGAGGG + Intronic
1059080808 9:111247516-111247538 TAACAATGATTGAATCTAGATGG + Intergenic
1188295969 X:28448823-28448845 TAACGCTGATTGAATCATGACGG + Intergenic
1188550078 X:31354014-31354036 AAACCTTGATTGATACACGAGGG + Intronic
1188573252 X:31615116-31615138 TAACCTTGAATAATTTTTTAGGG - Intronic
1189164568 X:38847973-38847995 TGGCCTTGATTGAGTCTTTAGGG - Intergenic
1194620487 X:96164815-96164837 TTACATTGGTTGAATCTTGAAGG - Intergenic
1195862621 X:109397952-109397974 TAATCTTGATTGCTTGTTTAAGG + Intronic
1198481602 X:137046407-137046429 GAGCCTTGATTGTTTCTGGAAGG + Intergenic
1198817038 X:140602618-140602640 TATTCTTGCTTGATTCTTGATGG - Intergenic
1199030479 X:142993085-142993107 TACCCTTTATTAATTTTTGATGG - Intergenic
1200679774 Y:6196297-6196319 TAACCTTCCTTGATTTTAGAGGG + Intergenic