ID: 1074486220

View in Genome Browser
Species Human (GRCh38)
Location 10:113884000-113884022
Sequence CTGGAGGCATGATGGGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 303}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074486220 Original CRISPR CTGGAGGCATGATGGGAGAT GGG Intronic
900483592 1:2910949-2910971 CTGGAGGCCTGAGGGGTGGTGGG + Intergenic
901819339 1:11816696-11816718 CTGGAGGGATGGTGGGCCATAGG + Intronic
902557597 1:17256137-17256159 CTGGAGGCAGGATGAGACAGTGG - Intronic
903357855 1:22759003-22759025 ATGGATGGATGATGGGTGATGGG + Intronic
904377077 1:30088388-30088410 CTGGAGGGATGAACGGAGAAGGG - Intergenic
904451545 1:30616027-30616049 CAGGAGGCAAGTTGTGAGATGGG - Intergenic
905284152 1:36868378-36868400 CAGGAGCCATGCTGGGAGAAAGG - Intronic
905415203 1:37799283-37799305 ATGGAGGCAGGATGGGAGCCTGG + Intronic
906296459 1:44651803-44651825 CTGGTGGCAGGATGGGGGAAAGG + Intronic
906474186 1:46156821-46156843 GTTGAGGCATGGTAGGAGATGGG - Intronic
909043962 1:70686741-70686763 CTGGAGGCAGGAGGGTCGATGGG + Intergenic
913314264 1:117536780-117536802 GGGGAGCCATGATGGGAGAAGGG + Intergenic
914884502 1:151574154-151574176 CTGGAGCCATGACGGGAGAAAGG - Intronic
916837358 1:168560868-168560890 CTGGAGGCTTGGTGGGAGAGAGG + Intergenic
919926271 1:202193448-202193470 GTGGAGGCATGAGGGGCAATGGG + Intergenic
921516976 1:216105324-216105346 TTGTATGCATGATGTGAGATAGG + Intronic
923826888 1:237510141-237510163 CTGGAGGCAGGAAGAGAGACAGG + Intronic
924568146 1:245214943-245214965 AGGGAGGCATCTTGGGAGATCGG + Intronic
924603233 1:245509848-245509870 CTGAAGGCAGGAAGGGAGAAGGG - Intronic
924727398 1:246683243-246683265 TTGGAGGCAGAAGGGGAGATGGG + Intergenic
924790134 1:247238597-247238619 CTGGAAGCATGCCGGGAGAGTGG + Intergenic
1063009883 10:2011728-2011750 CTGGAAGGCTGAGGGGAGATGGG - Intergenic
1064063358 10:12158800-12158822 CTGGAGGCAGGGTGGGAGATAGG - Intronic
1064742341 10:18446524-18446546 CTGGAGACAAGAGAGGAGATGGG + Intronic
1065338153 10:24676230-24676252 CTTGAAGAATGATGGGAGATAGG - Intronic
1066601309 10:37110502-37110524 CTGCAGGCATGATGAGGGGTAGG + Intergenic
1068600252 10:58949200-58949222 CAGGAGGCAAGATGGAAGAGTGG + Intergenic
1069347837 10:67490581-67490603 GTGGAGGGATGGTGGGAGATGGG + Intronic
1069607890 10:69751573-69751595 CTGCAGGCAGGAAGGGAGAGGGG + Intergenic
1069737805 10:70669030-70669052 CTGGTGGCCTGCTGGGAGATGGG + Intergenic
1069875087 10:71557423-71557445 CTGGAGGCTTGATGTGGGGTGGG + Intronic
1070780592 10:79135458-79135480 CTGGTGGCTTGGTGGGAAATGGG - Intronic
1072245855 10:93543200-93543222 CTGCAGGCAGGATGGCAGAGAGG - Intergenic
1072297075 10:94019465-94019487 CTGGAAGCAGGGTGGGTGATGGG - Intronic
1073010748 10:100357534-100357556 CTGAAGGCATGTTGGGGGAAGGG - Intronic
1074486220 10:113884000-113884022 CTGGAGGCATGATGGGAGATGGG + Intronic
1074808076 10:117073937-117073959 CTGCAGGCATTCTGGGATATAGG - Intronic
1076338685 10:129728055-129728077 CTCAAGGCATGATGGGAGCCAGG + Intronic
1076889104 10:133275324-133275346 CTGGAGGGAGGAACGGAGATGGG + Intronic
1077319875 11:1936386-1936408 CTGCAGGCACGAGGGGAGAGCGG - Intronic
1077546101 11:3170708-3170730 CTGGAGGCAAGGAGGGAGGTTGG + Intergenic
1077659543 11:4055289-4055311 CTGGAGCCAGGAAGGGAGCTGGG - Intronic
1078599463 11:12717506-12717528 CTTGCCGCATGCTGGGAGATGGG + Intronic
1078877633 11:15414068-15414090 CGGGAGGGAAGATGGGACATGGG + Intergenic
1080646978 11:34194549-34194571 CTGGGGCCTTGATGGGACATTGG + Intronic
1081062514 11:38497909-38497931 GTGGAGGCAAGATGGAATATAGG - Intergenic
1081710847 11:45214393-45214415 CTGGGGGCAGGATGGGAGGGTGG - Intronic
1082572309 11:54758837-54758859 TTGGGAGCATGATGGGAGACTGG - Intergenic
1082829416 11:57604428-57604450 CTGGAGTCATGGTGGGAGTGGGG + Intronic
1083763569 11:64831770-64831792 CTGGAGGCAGGAAGGGAGGGAGG - Intronic
1084020389 11:66413809-66413831 AAGGAGGCATGCTGGGAGTTTGG - Intergenic
1084251065 11:67899649-67899671 CTGGAGGCTTGACTGGTGATTGG - Intergenic
1084344956 11:68540623-68540645 CTGGGAGCATTATGGGAGACTGG + Intronic
1084673920 11:70623438-70623460 CTGGCTGCATGATGGGACAGAGG - Intronic
1085579401 11:77637476-77637498 CTGGAGGCCTGCTGGGAGCGGGG - Intronic
1085889534 11:80561467-80561489 CTGCAGGCATGATGAGGGGTAGG + Intergenic
1086960090 11:92972543-92972565 GTGGAGGCAAGGTGGGAGGTAGG + Intronic
1087642160 11:100766903-100766925 CTGGAAGCATAATGAGAGACAGG - Intronic
1089214464 11:116827393-116827415 GGGGAGCCATGATGGGAGAGAGG + Intergenic
1089677807 11:120102083-120102105 AAGGAGTTATGATGGGAGATGGG - Intergenic
1089679338 11:120110650-120110672 GAGGAGGCATGATGGTAGAGAGG - Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1092997921 12:13967816-13967838 TTGCAGGCATGAGGGGAGGTGGG + Intronic
1093557003 12:20488220-20488242 TTGGAGGCATAAGGGGAGATTGG - Intronic
1093720426 12:22436578-22436600 CTGTAGGGATCATGGCAGATGGG + Intronic
1094477490 12:30852446-30852468 ATGGAGGCATGCAGGGAGAAAGG - Intergenic
1095987775 12:48010907-48010929 CTGGAGGCTGGAGTGGAGATCGG - Intergenic
1096428020 12:51520743-51520765 CTGGGAGCAGGATGAGAGATGGG + Intergenic
1097269597 12:57765908-57765930 CTGGGGGCATGGTGGGAGGTCGG - Intronic
1097450662 12:59733722-59733744 CTGGAGGTGAGATGGGAGCTTGG - Intronic
1099067118 12:77995477-77995499 CTGAAGGCATGATGGTAGCATGG + Intronic
1099454642 12:82849009-82849031 ATGGAGAAGTGATGGGAGATTGG + Intronic
1100335037 12:93621003-93621025 CTGCAGTCATGATGGGAGGTTGG + Intergenic
1100691809 12:97046409-97046431 ATGGTGGAATGGTGGGAGATGGG - Intergenic
1101761004 12:107659129-107659151 CTGAAGGCATGCTAGGAAATAGG - Exonic
1102411338 12:112722193-112722215 TCTGAGGCATGATGGGAGGTAGG - Intronic
1102491335 12:113291207-113291229 CTGGGGACATGCAGGGAGATGGG - Intronic
1103988195 12:124780981-124781003 CTGGAGGAATCCTGGGAGAGAGG + Intronic
1105896821 13:24723703-24723725 CTGGAGTCATGAAGGGAGGCAGG - Intergenic
1107048988 13:36027400-36027422 CTGGTGGCATGTTAGGAGCTGGG - Intronic
1107331433 13:39305397-39305419 TTGGAGGCTGGATGGGAGAATGG + Intergenic
1107844054 13:44492681-44492703 CTGGAGGAATGGTGGAGGATGGG + Intronic
1108212567 13:48153034-48153056 CTGTTGGAAGGATGGGAGATGGG - Intergenic
1108622829 13:52200795-52200817 CAGGAGGACTTATGGGAGATGGG + Intergenic
1110073681 13:71211554-71211576 CAGGAGGCATGATTGGTGGTGGG + Intergenic
1110463436 13:75773266-75773288 TTGGAGGCAGGATGAGAGGTAGG + Intronic
1111288358 13:86126660-86126682 CTGTAGACATGATGTGAGCTGGG + Intergenic
1112294067 13:98171089-98171111 CTGGAAGCAGGATGGAAGAAGGG + Intronic
1114998200 14:28386754-28386776 TTGGGAGCATGATGAGAGATAGG + Intergenic
1116190067 14:41653715-41653737 AGGGAGGCAGGATGGGAGATAGG + Intronic
1116799579 14:49429131-49429153 CTAGAAGCATGGTGGGGGATGGG - Intergenic
1117768330 14:59106964-59106986 TTGGAGGGATCATGGCAGATGGG + Intergenic
1119620153 14:76125798-76125820 CAGACGGCATGATGGGAGTTTGG + Intergenic
1119886644 14:78149158-78149180 TAGGAGACATGATGGGAGGTAGG + Intergenic
1120766641 14:88333432-88333454 TTGCAAGCATGATGGGAGTTAGG + Intergenic
1120777400 14:88452688-88452710 CTGGAGGGAAGATGGTAGATAGG - Intronic
1122580998 14:102771512-102771534 CTGAAGGCATCATGGGAGACCGG - Intergenic
1123413892 15:20081359-20081381 CAGGAGGCAAGAAGGGTGATGGG + Intergenic
1123523234 15:21088470-21088492 CAGGAGGCAAGAAGGGTGATGGG + Intergenic
1124479437 15:30065003-30065025 CTGGAGGCATGAATGGAGGCTGG - Intergenic
1124856130 15:33391121-33391143 CTGGAGGGATGAGGGGAAAGAGG - Intronic
1128745419 15:70110920-70110942 CTGGAGGCAGGATGGGGCATAGG - Intergenic
1130159562 15:81385212-81385234 CTGCAGGCCTGAAGGGAGGTGGG + Intergenic
1132223548 15:100123475-100123497 CTGGAGGCCTCATGGGACCTCGG - Intronic
1135269596 16:21057668-21057690 CTGAAGGCAGGACGGGAGGTGGG + Intronic
1135274289 16:21098114-21098136 CTGGTGTCATGAAGGGATATGGG + Intronic
1135639094 16:24104788-24104810 CTGGATCCATGAGGGGAGAGTGG + Intronic
1136002455 16:27305173-27305195 TTGGAGGCAGAAGGGGAGATGGG - Intergenic
1138283069 16:55786729-55786751 CTGGAGTTATCATGGGACATAGG + Intergenic
1140270728 16:73464345-73464367 CTGGAGGGAAGATGGGGGAGGGG + Intergenic
1141295660 16:82766370-82766392 ATGGAGGCATGATCTGAGGTTGG + Intronic
1141544548 16:84756099-84756121 CTGAAGGGGTGTTGGGAGATGGG - Intronic
1142334882 16:89481704-89481726 CTGGAAGCATGACTGGAGTTGGG - Intronic
1142399705 16:89852508-89852530 GTGGAGGGAGGATGGAAGATGGG - Intronic
1142399738 16:89852586-89852608 GTGGAGGGAGGATGGAAGATGGG - Intronic
1144156583 17:12509891-12509913 CAGGAGAGATGATGGAAGATTGG + Intergenic
1144366749 17:14551715-14551737 CTGGGGTCCTGATGGCAGATCGG - Intergenic
1144623840 17:16834454-16834476 CTGCAGGCATGGTGGGAGCCTGG - Intergenic
1144839315 17:18175876-18175898 CTGGAGGAATGAGCAGAGATGGG - Intronic
1144882591 17:18438262-18438284 CTGCAGGCATGGTGGGAGCCTGG + Intergenic
1145149643 17:20506124-20506146 CTGCAGGCATGGTGGGAGCCTGG - Intergenic
1145242045 17:21245800-21245822 CTGCAGGCATGAGGGGAGTGGGG - Intronic
1145255705 17:21321167-21321189 CTGGAGCCCTGATTGGAGCTAGG + Intergenic
1145320909 17:21766781-21766803 CTGGAGCCCTGATTGGAGCTAGG - Intergenic
1145779290 17:27551768-27551790 CTGGAGGCAGGGAGGGAGAGAGG - Intronic
1146521127 17:33526457-33526479 CGGGGGACATGCTGGGAGATTGG - Intronic
1146683972 17:34827975-34827997 GTGGAGGGGTGATGGGAGCTGGG + Intergenic
1147335610 17:39725447-39725469 CTGGAGGGAGGATGAGAGCTGGG + Intronic
1147578130 17:41614158-41614180 CTGCAGGCATGGTGGGAGCCTGG - Intronic
1148606454 17:48932814-48932836 CTTAAGGCATGATGAGGGATGGG + Intronic
1149575236 17:57707270-57707292 CTGGAGGCTGGGAGGGAGATGGG - Intergenic
1150411002 17:64940571-64940593 CTGGAAGCAGCCTGGGAGATGGG - Intergenic
1150880124 17:69015062-69015084 CTGGAGGCAGAATGGAAGAATGG - Intronic
1151345219 17:73497300-73497322 CTAGAGGCTGGATGGGAGAGGGG - Intronic
1152800735 17:82329614-82329636 CTGGACGTATGATGGGAGATGGG - Intronic
1153337410 18:3938808-3938830 CTGGAGGCATGCTGGCTGCTGGG + Intronic
1155727081 18:29100079-29100101 CTGCAGACAAGATGGGAGATGGG - Intergenic
1155886721 18:31217382-31217404 CTGCAGCCACGATGGGGGATGGG - Intergenic
1159463173 18:68745719-68745741 CGGGAGGCATGAAGGGAGGTAGG - Intronic
1160752553 19:741362-741384 CTGGAGGGCTGAGGGGAGTTGGG + Intronic
1161362030 19:3855835-3855857 CGGAAGGAATGAGGGGAGATGGG + Intronic
1162867615 19:13560729-13560751 CTGGAGTCAAGATGGGAATTTGG - Intronic
1164887597 19:31795686-31795708 CTGGAGGCAGGTTGGGGCATGGG - Intergenic
1165963341 19:39553450-39553472 CAGGAGTCGTTATGGGAGATGGG - Intergenic
1167322547 19:48805840-48805862 GGGGAGGCATGGTGGGAGAGGGG - Intronic
925371646 2:3349654-3349676 CAGGGAGCATGCTGGGAGATGGG + Intronic
925371659 2:3349704-3349726 CAGGGAGCATGCTGGGAGATGGG + Intronic
926206167 2:10835512-10835534 CTGGAGGCCTGAAGGCAGGTGGG + Intronic
927102700 2:19800178-19800200 CTGGAGGCATGCTGCTGGATGGG - Intergenic
927220393 2:20702774-20702796 ATGGAGGCAGGATGGGAGGAAGG - Intronic
928737447 2:34308662-34308684 ATGGAGGCAGGGTGGGAGAAAGG - Intergenic
928750359 2:34463452-34463474 CTGAAGGCTTGATTGGAGCTGGG - Intergenic
928942697 2:36742597-36742619 CTGGTGGGAGGATGGTAGATTGG - Intronic
929398130 2:41547061-41547083 CTGGGGGAATGATGAGAGCTAGG - Intergenic
930599577 2:53427680-53427702 CTGTAGGCAGAATGTGAGATTGG - Intergenic
932774284 2:74518001-74518023 ATGAAGGCCTGATTGGAGATGGG + Intergenic
935697952 2:105786365-105786387 CTGGGGACAGGATGGGAGTTCGG + Intronic
936354575 2:111739141-111739163 ATGGAGGCATGAGTGGAGTTGGG + Intergenic
936578178 2:113672557-113672579 CTGGAGGGATGATGGAAGGAGGG - Intergenic
938081438 2:128372386-128372408 AAGGAGGCATCATGGGAGAATGG - Intergenic
938310633 2:130286297-130286319 CTGGAGGCATGAGGACAAATGGG - Intergenic
938768380 2:134479261-134479283 CAGGGGGCATGTTGGGAGAAGGG - Intronic
938993384 2:136652680-136652702 CTGGAGGCCTGTTAGGAGACCGG + Intergenic
940161560 2:150719493-150719515 ATGGTGGCATGGTGGGTGATGGG - Intergenic
940236182 2:151513053-151513075 TTGGATGCAGGATGGGATATGGG + Intronic
940900682 2:159123877-159123899 CTGGGGGCACGAGGGGAGACTGG - Intronic
942860840 2:180609950-180609972 TTGGAGCCATAAAGGGAGATGGG - Intergenic
943799005 2:192034397-192034419 ATGGAGGAGTGATGGGAGAGTGG - Intronic
945719354 2:213400044-213400066 CAGGAAGAATGATGTGAGATGGG - Intronic
946606259 2:221408688-221408710 AAGGAGGCAGGCTGGGAGATAGG - Intergenic
946646242 2:221837805-221837827 ATGGAAGCAGGTTGGGAGATAGG - Intergenic
948125430 2:235561500-235561522 TTGGAGGGATGCTGGGAGAAGGG + Intronic
948689499 2:239692952-239692974 GTGGGGGACTGATGGGAGATTGG - Intergenic
1168883442 20:1226179-1226201 CTGTAGGCGGGCTGGGAGATGGG + Exonic
1169210584 20:3764287-3764309 CAGGAAGCATCCTGGGAGATGGG - Intronic
1172091912 20:32438846-32438868 CTGGAAACATGTTGGGAGAGAGG - Exonic
1172140449 20:32719224-32719246 CTGGAGTCTGGATGGGAGAATGG + Intronic
1175791448 20:61742794-61742816 CTGGAGCCGTGAAGGGAGGTTGG + Intronic
1175930595 20:62492072-62492094 CTGGAGGCCTGCAGGGAGAGTGG + Intergenic
1176093378 20:63328793-63328815 CGGGAGGAAGGATGGGAGGTAGG - Intronic
1176298157 21:5085357-5085379 CTGGAGGCTGGAAGGCAGATCGG - Intergenic
1176964845 21:15200754-15200776 CAGGAGGGACGTTGGGAGATTGG + Intergenic
1177561341 21:22758451-22758473 CTGGAGGCCTGATGTGGTATGGG - Intergenic
1178169157 21:30019405-30019427 CTGGAGGCAGGATGGTAGGGAGG + Intergenic
1178913214 21:36692997-36693019 TGGGAGGGAGGATGGGAGATGGG + Intergenic
1179008764 21:37537029-37537051 GTGGATGCATAATGGGAGAGAGG + Intergenic
1179858872 21:44176592-44176614 CTGGAGGCTGGAAGGCAGATCGG + Intergenic
1179980816 21:44894812-44894834 CTGGAGGCCTGAGGGCAGGTCGG + Intronic
1180025067 21:45156236-45156258 CTGGATAGATGATGGGTGATGGG - Intronic
1180025079 21:45156284-45156306 ATGGATGGATGATGGGTGATGGG - Intronic
1180025102 21:45156372-45156394 ATGGATGGATGATGGGTGATGGG - Intronic
1182092402 22:27604761-27604783 CTGGGGGCTTGATTGGAGACTGG - Intergenic
1182168325 22:28199828-28199850 CTGGAGGAAAAATGGGAGAGGGG + Intronic
1182546227 22:31078209-31078231 CAGGAGGCAAGAAGGGTGATGGG - Intronic
1183744255 22:39684313-39684335 CTGGAGGCATCCGGGGAGAAGGG - Exonic
1184425356 22:44406033-44406055 CTGGGAGAATGAAGGGAGATGGG - Intergenic
1184852373 22:47128127-47128149 GTGGAGGGAGGATGGGGGATGGG - Intronic
1184852386 22:47128154-47128176 GTGGAGGGAGGATGGGGGATGGG - Intronic
949985599 3:9538193-9538215 TTGGAGGCTTGATGGGAGGAGGG - Intronic
950193746 3:10994693-10994715 CTGGAGGCTTGATGAGAAGTGGG + Intronic
950725064 3:14911945-14911967 CTGGAGGAAGGATGGGAGTTTGG + Intronic
951833170 3:26952493-26952515 TTGAAGCCATGATGGGAAATGGG - Intergenic
952286063 3:31970882-31970904 TTGGAGGCATGAAAGGAGATAGG - Intronic
953411693 3:42693819-42693841 CTGCAGGAAAGATGGGAGAAGGG + Intronic
954636650 3:52074469-52074491 CTGGGGGACTGATGGGGGATGGG + Intergenic
955029334 3:55201218-55201240 CTGGAGGGAAAATGGGAGACAGG - Intergenic
955167875 3:56532677-56532699 CTGGATGCATGACTGGAGAAAGG + Intergenic
955522450 3:59788161-59788183 CAGGAGAAATGATGGGAGAGGGG - Intronic
956858054 3:73295058-73295080 TTGGAGGCATGAGAGGAGAAAGG + Intergenic
957366991 3:79238303-79238325 TTGGAGGCAGGATGGGATAGCGG - Intronic
958944702 3:100350190-100350212 CTGGTTGCATGGTGGAAGATGGG + Intronic
961656894 3:128447713-128447735 CTGAAGGCTTGACGGGGGATGGG + Intergenic
961866999 3:129960805-129960827 CTGTTGGGATGATGGGAGCTTGG - Intergenic
962342081 3:134594302-134594324 CTGGTGGCATGAGGGCAGAGGGG - Intergenic
962706430 3:138049100-138049122 CTGGAGGCAAGAAAGGACATTGG - Intergenic
962892025 3:139680266-139680288 CTTGAGCCATAATGGCAGATAGG - Intergenic
962973077 3:140423323-140423345 CTGGAGACATAATAGCAGATGGG - Intronic
963074050 3:141330139-141330161 CTGGAGTCATGATGGGCACTGGG + Intronic
963150380 3:142039807-142039829 ATGGAGGCATGATGGGACTGAGG + Intronic
964653509 3:159040192-159040214 CTGGAGGAATGCTGGAAGAGAGG - Intronic
966807702 3:183819533-183819555 CTGGAGCCCAGATGGGAGAGGGG + Intronic
968682136 4:1928710-1928732 CTGGAGTCATGGTGGGTGATGGG + Intronic
968903173 4:3440599-3440621 GTGGAGGCATGGTGGGTGCTGGG - Intergenic
968903209 4:3440688-3440710 GTGGAGGCATGGTGGGTGCTGGG - Intergenic
969437653 4:7198036-7198058 CTGGAGGCACTGTGGGGGATGGG + Intronic
969946267 4:10786515-10786537 CTAGAGGAATTATGGTAGATGGG + Intergenic
969967762 4:11014507-11014529 CAGGAGGCATGAGGGTGGATGGG + Intergenic
970764033 4:19525085-19525107 CTGGAGACAAGATGGAATATTGG + Intergenic
972419175 4:38870166-38870188 ATGGAGGAATGATGAGAGGTGGG - Intronic
973169144 4:47117319-47117341 CTGGAGGCTTGATGTTATATAGG - Intronic
973590450 4:52435545-52435567 CAGGAGACATGAAGGGAGAGAGG - Intergenic
974208857 4:58743400-58743422 CTGGAAGCACTATGGGAGACTGG + Intergenic
974983319 4:68989253-68989275 CTGGGAGCACTATGGGAGATGGG - Intergenic
975614996 4:76237269-76237291 CCTGAGGCATGATGGGAAGTGGG - Intronic
976198321 4:82555540-82555562 GAGGAGGCCTGATGGGTGATAGG - Intronic
976627884 4:87206590-87206612 CTGTAGAAATGGTGGGAGATGGG + Intronic
979980017 4:127243338-127243360 CTGGTGGCATGAAAGGAGAGAGG + Intergenic
982090599 4:151876808-151876830 CTGGAGGAAAGATGGTAGAATGG - Intergenic
983637661 4:169914563-169914585 ATGGTGGGGTGATGGGAGATGGG + Intergenic
984624152 4:181986930-181986952 CTGGAGCAATGATGGGAGAATGG + Intergenic
985796659 5:1967095-1967117 CTGGAGTTATGCTGGGAGATGGG + Intergenic
985909544 5:2868100-2868122 TTACAGGCATGATGGGGGATGGG + Intergenic
986479861 5:8175995-8176017 CTGAGGGCATGGTGGGAGGTGGG + Intergenic
986586432 5:9322756-9322778 CTTGAGGCATAATGGGACAAAGG - Intronic
986825788 5:11520718-11520740 CAGGAGGCATGACAGGTGATGGG - Intronic
987258119 5:16178933-16178955 CTGGAGGCAAACTGGGAGGTAGG + Intronic
988536170 5:32071175-32071197 CTTGAAGCATCATGGCAGATGGG + Intronic
992075342 5:73187654-73187676 CTGGTGGCATCATAGGTGATGGG + Intergenic
992170291 5:74094885-74094907 CAGGAGCCATGGTGGGGGATGGG - Intergenic
992678245 5:79127199-79127221 CTGAAGGCCTGTTGGGAGCTGGG + Intronic
995503835 5:112837677-112837699 CAGGAAGCATTATGGGACATGGG + Exonic
997076651 5:130686707-130686729 CTGGAGGCATTTGGAGAGATTGG + Intergenic
997242681 5:132319364-132319386 GTAGAGACATGAGGGGAGATGGG - Intronic
997599931 5:135132236-135132258 CTGGAGCCATGGGGGGAGCTGGG + Intronic
997725068 5:136113581-136113603 ATGGAGGCATGGAGGGAGAGAGG + Intergenic
998770025 5:145532611-145532633 CTGGGGGCAGGATGGGGAATGGG - Intronic
1000272190 5:159696721-159696743 CTGGGGACATAATGAGAGATGGG + Intergenic
1000286475 5:159830799-159830821 CTGGCTGCATGATGGTAGACAGG + Intergenic
1001260636 5:170225503-170225525 CAGGAGGCATCCTGGCAGATGGG - Intergenic
1001489049 5:172142828-172142850 CTTGAGGCATGAGGAGGGATGGG - Intronic
1002210122 5:177593762-177593784 CTGGAGGCATGCTGGTAAGTGGG + Exonic
1004495174 6:16156178-16156200 CTGGAGGCAGGGTGGGCCATGGG + Intergenic
1004977689 6:20985963-20985985 CTGGAGCTATGATGAGAGAATGG - Intronic
1005072469 6:21874489-21874511 CAGGGGGCATGATGGGAGTGAGG + Intergenic
1006729873 6:36228879-36228901 CTGGAGGCAGAATAGAAGATGGG - Intronic
1008625253 6:53309361-53309383 AAGGAGGCAAGATGGGTGATAGG + Intronic
1013800768 6:113939293-113939315 CGGGAGGCATGGTGGGAGGGGGG + Exonic
1014072452 6:117198811-117198833 CTGAAGGCATCAAGAGAGATGGG + Intergenic
1014248363 6:119091722-119091744 CTGGAGGGAGGATGAGGGATCGG + Intronic
1016842039 6:148534304-148534326 CTGGAGTGATGGTGGGAGAGAGG - Intronic
1019539893 7:1546797-1546819 CTGGAGGGAGGATGGGAAGTGGG + Exonic
1019737722 7:2658918-2658940 CCTGAGGCATGAGGGGAGAGAGG - Exonic
1022186405 7:27973864-27973886 ATGGAGGCAGGCAGGGAGATCGG + Intronic
1023987037 7:45102788-45102810 TTGGAGACATTATGGGAGAAGGG - Intronic
1024967389 7:55036093-55036115 ATGGAGGCATGAGGAGAAATGGG + Intronic
1025772658 7:64527776-64527798 CTGGGGGCATCATGGTGGATGGG + Intronic
1027895979 7:84045369-84045391 ATGGAGGGATAATTGGAGATTGG + Intronic
1029544986 7:101205932-101205954 CTGCTGGCAGGAGGGGAGATGGG + Intergenic
1030411663 7:109188917-109188939 CAGGTGGAAAGATGGGAGATTGG - Intergenic
1035325035 7:158060347-158060369 CTGGGGGCTGCATGGGAGATGGG - Intronic
1035413485 7:158665287-158665309 CTGGAGGCTGCATGTGAGATGGG - Intronic
1035582090 8:746871-746893 CTGAAGGCATGATGCGAGGACGG + Intergenic
1035670317 8:1412074-1412096 CTGGAGGCAGGAATGGAGAAAGG - Intergenic
1035920894 8:3675123-3675145 CTTGAGCCATGATGGGAAAGTGG - Intronic
1036405972 8:8455631-8455653 TTGGAGCCATGAAGGGAGATGGG + Intergenic
1036442041 8:8789937-8789959 CTGGGGGCAGGAGGGGAGAGGGG - Intronic
1037088622 8:14884831-14884853 CTGGAGGATTGAAAGGAGATGGG - Intronic
1041184683 8:55286657-55286679 CTGAAGGCATGCTGTGAGAAAGG - Intronic
1043642641 8:82474831-82474853 ATAGAGGCATTATGGGAGAAAGG + Intergenic
1045352457 8:101354565-101354587 CTGGAGGAAGTATGAGAGATAGG + Intergenic
1046714933 8:117557157-117557179 CTGAAGACATGATGGGAAAGGGG - Intergenic
1048021292 8:130541759-130541781 CTGGGGACATGATTGGAGAAGGG - Intergenic
1050033675 9:1412872-1412894 CGGGAGGGATGGTGGGAGATCGG + Intergenic
1050418832 9:5441028-5441050 CGGGAGGCATTCAGGGAGATGGG + Intergenic
1051061314 9:13047998-13048020 CTGGAGACATTATGTGTGATTGG + Intergenic
1052215055 9:25956829-25956851 CAGGAGGCATTATGGAAGAGTGG - Intergenic
1052303284 9:26976531-26976553 GTGGGCGCATGATGGGAGAGAGG + Intronic
1053121993 9:35554454-35554476 GTGCTGGCATGATTGGAGATGGG + Intronic
1053433280 9:38058199-38058221 GAGGAGGCCTCATGGGAGATGGG - Intronic
1054967033 9:71040973-71040995 CTGGAGGCAACATGGGACCTAGG + Intronic
1055550947 9:77431792-77431814 CTGGAGGGAGGATGACAGATGGG - Intronic
1056691693 9:88813461-88813483 CAGGAGGCCTGATGGGATGTGGG - Intergenic
1056704394 9:88939754-88939776 CTGGAGGGAAGGTGGGAGAGGGG - Intergenic
1057414244 9:94847213-94847235 CTGCAGGCATGGTGGGAGGGTGG - Intronic
1058746168 9:107992824-107992846 CTGGAGGCATGCAGGAAGCTTGG - Intergenic
1059506442 9:114803670-114803692 TTGGAGGCAGGGTGGGGGATGGG + Intronic
1060826264 9:126689712-126689734 CTGCAGAGATGATGGGAGATGGG + Intronic
1060942973 9:127553914-127553936 CTGGAGGTCTGATGGGTCATAGG + Intronic
1060982281 9:127800296-127800318 CTGGGGGCATCCTGGGAGAGGGG + Intronic
1061235021 9:129337137-129337159 CTGGAGGCAGGAGGGGAGCCGGG + Intergenic
1061328515 9:129878474-129878496 CTGGGGGCCTCCTGGGAGATGGG + Intronic
1062154277 9:135037778-135037800 CTAGAGGCATGATGAGAGCGGGG + Intergenic
1062703161 9:137918643-137918665 CTGGTGGCATGATGGTGGACAGG + Intronic
1186704888 X:12130393-12130415 CTGGATGCTGGATGGGAGGTGGG + Intergenic
1187568900 X:20480986-20481008 CTTGTGGTATGATGGGAGAGTGG + Intergenic
1188378450 X:29462555-29462577 CTGGAGGCAGCAGGGGAGAGAGG - Intronic
1188745190 X:33832739-33832761 GTGGAGGCTGGGTGGGAGATGGG - Intergenic
1190067136 X:47249158-47249180 CTGGGGTCATGATGGGAGAGGGG - Intergenic
1191064325 X:56331271-56331293 CTGGAAGCACTATGGGAGACTGG - Intergenic
1192179945 X:68910152-68910174 CTGGAGGCCCCATGGGAAATAGG - Intergenic
1192233945 X:69284536-69284558 CTGGGGGCAGGATGGGAGGTGGG - Intergenic
1192639456 X:72848107-72848129 GGGGAGGCAAGATGGGAGATGGG + Intronic
1192642255 X:72872698-72872720 GGGGAGGCAAGATGGGAGATGGG - Intronic
1192991845 X:76467696-76467718 GGGGAGGCATGGTGTGAGATTGG - Intergenic
1193472692 X:81926130-81926152 CTTGTGGCATGATGGGACAGTGG - Intergenic
1194350765 X:92823152-92823174 CTTGAGGCAGGTTGGGGGATTGG + Intergenic
1195176048 X:102316458-102316480 CTGGAGGCAGGAGGGCAGCTTGG + Intronic
1195182816 X:102370635-102370657 CTGGAGGCAGGAGGGCAGCTTGG - Intronic
1195237018 X:102910837-102910859 ATGGGGGCAAGATGGCAGATAGG + Intergenic
1196008862 X:110865172-110865194 CTGCAGGCAAGAAGGGAGCTTGG + Intergenic
1201903108 Y:19063403-19063425 GTGGGCGCATGATGGGAGAGAGG + Intergenic
1202132725 Y:21628481-21628503 CTGGAAGCACTATGGGAGACTGG + Intergenic