ID: 1074489026

View in Genome Browser
Species Human (GRCh38)
Location 10:113922231-113922253
Sequence ACTTGTAACAGCAAGGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074489026_1074489035 25 Left 1074489026 10:113922231-113922253 CCTTGCACCTTGCTGTTACAAGT No data
Right 1074489035 10:113922279-113922301 CTGTGGTTCAGTGTTGTAGGTGG No data
1074489026_1074489030 -6 Left 1074489026 10:113922231-113922253 CCTTGCACCTTGCTGTTACAAGT No data
Right 1074489030 10:113922248-113922270 ACAAGTTGTAGGATACCCTTGGG No data
1074489026_1074489034 22 Left 1074489026 10:113922231-113922253 CCTTGCACCTTGCTGTTACAAGT No data
Right 1074489034 10:113922276-113922298 TTGCTGTGGTTCAGTGTTGTAGG No data
1074489026_1074489031 8 Left 1074489026 10:113922231-113922253 CCTTGCACCTTGCTGTTACAAGT No data
Right 1074489031 10:113922262-113922284 ACCCTTGGGTGTTTTTGCTGTGG No data
1074489026_1074489029 -7 Left 1074489026 10:113922231-113922253 CCTTGCACCTTGCTGTTACAAGT No data
Right 1074489029 10:113922247-113922269 TACAAGTTGTAGGATACCCTTGG No data
1074489026_1074489036 29 Left 1074489026 10:113922231-113922253 CCTTGCACCTTGCTGTTACAAGT No data
Right 1074489036 10:113922283-113922305 GGTTCAGTGTTGTAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074489026 Original CRISPR ACTTGTAACAGCAAGGTGCA AGG (reversed) Intergenic
No off target data available for this crispr