ID: 1074489586

View in Genome Browser
Species Human (GRCh38)
Location 10:113927233-113927255
Sequence GACTGGGCTTTCTCTACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074489586_1074489591 -4 Left 1074489586 10:113927233-113927255 CCAGGTGTAGAGAAAGCCCAGTC No data
Right 1074489591 10:113927252-113927274 AGTCCAGGGCTCTTCCTTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074489586 Original CRISPR GACTGGGCTTTCTCTACACC TGG (reversed) Intergenic
No off target data available for this crispr