ID: 1074492359

View in Genome Browser
Species Human (GRCh38)
Location 10:113949986-113950008
Sequence ACATTACTAAATTGCTACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074492359_1074492363 26 Left 1074492359 10:113949986-113950008 CCAGAGTAGCAATTTAGTAATGT No data
Right 1074492363 10:113950035-113950057 CCATGATCCTATAGTCTCCTTGG No data
1074492359_1074492360 -4 Left 1074492359 10:113949986-113950008 CCAGAGTAGCAATTTAGTAATGT No data
Right 1074492360 10:113950005-113950027 ATGTCTTTCTAGAACTGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074492359 Original CRISPR ACATTACTAAATTGCTACTC TGG (reversed) Intergenic
No off target data available for this crispr