ID: 1074492360

View in Genome Browser
Species Human (GRCh38)
Location 10:113950005-113950027
Sequence ATGTCTTTCTAGAACTGTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074492357_1074492360 -2 Left 1074492357 10:113949984-113950006 CCCCAGAGTAGCAATTTAGTAAT No data
Right 1074492360 10:113950005-113950027 ATGTCTTTCTAGAACTGTAAAGG No data
1074492359_1074492360 -4 Left 1074492359 10:113949986-113950008 CCAGAGTAGCAATTTAGTAATGT No data
Right 1074492360 10:113950005-113950027 ATGTCTTTCTAGAACTGTAAAGG No data
1074492358_1074492360 -3 Left 1074492358 10:113949985-113950007 CCCAGAGTAGCAATTTAGTAATG No data
Right 1074492360 10:113950005-113950027 ATGTCTTTCTAGAACTGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074492360 Original CRISPR ATGTCTTTCTAGAACTGTAA AGG Intergenic
No off target data available for this crispr