ID: 1074497294

View in Genome Browser
Species Human (GRCh38)
Location 10:113991351-113991373
Sequence CCTGGGGCCCAGAGAGATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074497294_1074497300 10 Left 1074497294 10:113991351-113991373 CCTTGATCTCTCTGGGCCCCAGG No data
Right 1074497300 10:113991384-113991406 CCTCTTCTCCAGCTACCACCTGG No data
1074497294_1074497301 14 Left 1074497294 10:113991351-113991373 CCTTGATCTCTCTGGGCCCCAGG No data
Right 1074497301 10:113991388-113991410 TTCTCCAGCTACCACCTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074497294 Original CRISPR CCTGGGGCCCAGAGAGATCA AGG (reversed) Intergenic
No off target data available for this crispr