ID: 1074497300

View in Genome Browser
Species Human (GRCh38)
Location 10:113991384-113991406
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074497296_1074497300 -6 Left 1074497296 10:113991367-113991389 CCCCAGGTTATCTCTCGCCTCTT No data
Right 1074497300 10:113991384-113991406 CCTCTTCTCCAGCTACCACCTGG No data
1074497298_1074497300 -8 Left 1074497298 10:113991369-113991391 CCAGGTTATCTCTCGCCTCTTCT No data
Right 1074497300 10:113991384-113991406 CCTCTTCTCCAGCTACCACCTGG No data
1074497294_1074497300 10 Left 1074497294 10:113991351-113991373 CCTTGATCTCTCTGGGCCCCAGG No data
Right 1074497300 10:113991384-113991406 CCTCTTCTCCAGCTACCACCTGG No data
1074497297_1074497300 -7 Left 1074497297 10:113991368-113991390 CCCAGGTTATCTCTCGCCTCTTC No data
Right 1074497300 10:113991384-113991406 CCTCTTCTCCAGCTACCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074497300 Original CRISPR CCTCTTCTCCAGCTACCACC TGG Intergenic
No off target data available for this crispr