ID: 1074500796

View in Genome Browser
Species Human (GRCh38)
Location 10:114022444-114022466
Sequence CTCCCGTCCAGGCCACTCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074500792_1074500796 18 Left 1074500792 10:114022403-114022425 CCGACACACACACGAGATAAAGG No data
Right 1074500796 10:114022444-114022466 CTCCCGTCCAGGCCACTCAGCGG No data
1074500791_1074500796 19 Left 1074500791 10:114022402-114022424 CCCGACACACACACGAGATAAAG No data
Right 1074500796 10:114022444-114022466 CTCCCGTCCAGGCCACTCAGCGG No data
1074500790_1074500796 20 Left 1074500790 10:114022401-114022423 CCCCGACACACACACGAGATAAA No data
Right 1074500796 10:114022444-114022466 CTCCCGTCCAGGCCACTCAGCGG No data
1074500788_1074500796 29 Left 1074500788 10:114022392-114022414 CCTGGCTACCCCCGACACACACA No data
Right 1074500796 10:114022444-114022466 CTCCCGTCCAGGCCACTCAGCGG No data
1074500789_1074500796 21 Left 1074500789 10:114022400-114022422 CCCCCGACACACACACGAGATAA No data
Right 1074500796 10:114022444-114022466 CTCCCGTCCAGGCCACTCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074500796 Original CRISPR CTCCCGTCCAGGCCACTCAG CGG Intergenic