ID: 1074501203

View in Genome Browser
Species Human (GRCh38)
Location 10:114026436-114026458
Sequence CCTAAAAATGTCCCCAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074501200_1074501203 -6 Left 1074501200 10:114026419-114026441 CCTCTCCAGTTTCAACACCTAAA No data
Right 1074501203 10:114026436-114026458 CCTAAAAATGTCCCCAGACATGG No data
1074501198_1074501203 -4 Left 1074501198 10:114026417-114026439 CCCCTCTCCAGTTTCAACACCTA No data
Right 1074501203 10:114026436-114026458 CCTAAAAATGTCCCCAGACATGG No data
1074501194_1074501203 29 Left 1074501194 10:114026384-114026406 CCTGGCCTCTACTAACTAGATGC No data
Right 1074501203 10:114026436-114026458 CCTAAAAATGTCCCCAGACATGG No data
1074501196_1074501203 7 Left 1074501196 10:114026406-114026428 CCAGTAGCAGCCCCCTCTCCAGT No data
Right 1074501203 10:114026436-114026458 CCTAAAAATGTCCCCAGACATGG No data
1074501199_1074501203 -5 Left 1074501199 10:114026418-114026440 CCCTCTCCAGTTTCAACACCTAA No data
Right 1074501203 10:114026436-114026458 CCTAAAAATGTCCCCAGACATGG No data
1074501195_1074501203 24 Left 1074501195 10:114026389-114026411 CCTCTACTAACTAGATGCCAGTA No data
Right 1074501203 10:114026436-114026458 CCTAAAAATGTCCCCAGACATGG No data
1074501197_1074501203 -3 Left 1074501197 10:114026416-114026438 CCCCCTCTCCAGTTTCAACACCT No data
Right 1074501203 10:114026436-114026458 CCTAAAAATGTCCCCAGACATGG No data
1074501193_1074501203 30 Left 1074501193 10:114026383-114026405 CCCTGGCCTCTACTAACTAGATG No data
Right 1074501203 10:114026436-114026458 CCTAAAAATGTCCCCAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074501203 Original CRISPR CCTAAAAATGTCCCCAGACA TGG Intergenic
No off target data available for this crispr