ID: 1074501375

View in Genome Browser
Species Human (GRCh38)
Location 10:114028047-114028069
Sequence CACTTTGTTTGAGGGGCACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074501375_1074501387 -9 Left 1074501375 10:114028047-114028069 CCCCGTGCCCCTCAAACAAAGTG No data
Right 1074501387 10:114028061-114028083 AACAAAGTGGGAATTGAGGGGGG No data
1074501375_1074501389 11 Left 1074501375 10:114028047-114028069 CCCCGTGCCCCTCAAACAAAGTG No data
Right 1074501389 10:114028081-114028103 GGGCAAACCAAGGATTGCAAAGG No data
1074501375_1074501386 -10 Left 1074501375 10:114028047-114028069 CCCCGTGCCCCTCAAACAAAGTG No data
Right 1074501386 10:114028060-114028082 AAACAAAGTGGGAATTGAGGGGG No data
1074501375_1074501388 1 Left 1074501375 10:114028047-114028069 CCCCGTGCCCCTCAAACAAAGTG No data
Right 1074501388 10:114028071-114028093 GAATTGAGGGGGGCAAACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074501375 Original CRISPR CACTTTGTTTGAGGGGCACG GGG (reversed) Intergenic
No off target data available for this crispr