ID: 1074503119

View in Genome Browser
Species Human (GRCh38)
Location 10:114043990-114044012
Sequence CGGCGCGGGGCCGGAGGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 194}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074503119_1074503137 27 Left 1074503119 10:114043990-114044012 CCCATGCCTCCGGCCCCGCGCCG 0: 1
1: 0
2: 0
3: 21
4: 194
Right 1074503137 10:114044040-114044062 CCTCTGCGCACCACGCCGCCCGG 0: 1
1: 0
2: 0
3: 10
4: 150
1074503119_1074503127 -6 Left 1074503119 10:114043990-114044012 CCCATGCCTCCGGCCCCGCGCCG 0: 1
1: 0
2: 0
3: 21
4: 194
Right 1074503127 10:114044007-114044029 GCGCCGCGGCTGCCCTGACCCGG 0: 1
1: 0
2: 2
3: 24
4: 178
1074503119_1074503138 28 Left 1074503119 10:114043990-114044012 CCCATGCCTCCGGCCCCGCGCCG 0: 1
1: 0
2: 0
3: 21
4: 194
Right 1074503138 10:114044041-114044063 CTCTGCGCACCACGCCGCCCGGG 0: 1
1: 0
2: 0
3: 15
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074503119 Original CRISPR CGGCGCGGGGCCGGAGGCAT GGG (reversed) Intergenic
900307794 1:2019512-2019534 CGGCGCGGGGTCGGGGGCGGTGG + Intronic
900420311 1:2553339-2553361 CGGGGCTGGGCTGGAGGCCTGGG + Intergenic
900424115 1:2568319-2568341 CGGGGCTGGGCTGGAGGCCTGGG - Intergenic
900548826 1:3243473-3243495 CGGCGGGCGGCCAGAGGCAGGGG - Intronic
901551156 1:9997213-9997235 CGGCGGGCGGCCGGAGGCTCGGG - Exonic
901629023 1:10639245-10639267 CGGCCCGGGGGCGGCGGCGTCGG + Exonic
903230739 1:21920934-21920956 CTGCCCGGGGGAGGAGGCATAGG - Intronic
904751047 1:32741702-32741724 CGGGGAGGGGCCGCAGGCAGCGG + Intergenic
906436801 1:45803538-45803560 CGGCGCGCGGCCGGAGGTGGCGG + Intronic
906632658 1:47385505-47385527 GGGGGCAGGGCCTGAGGCATTGG - Intergenic
907222989 1:52921175-52921197 CGGTTCGGGGGCGGAGGCAGCGG - Intronic
922766392 1:228158675-228158697 CGGCGCGGGGGCGGGGGCGGAGG - Exonic
922831645 1:228557390-228557412 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922832122 1:228609372-228609394 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922832682 1:228611613-228611635 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922833243 1:228613854-228613876 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922833803 1:228616095-228616117 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922834360 1:228618336-228618358 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922834922 1:228620567-228620589 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922835472 1:228622770-228622792 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922836030 1:228625012-228625034 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922836587 1:228627252-228627274 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922837147 1:228629493-228629515 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922837707 1:228631735-228631757 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922838265 1:228633975-228633997 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922838824 1:228636200-228636222 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922839383 1:228638441-228638463 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922839944 1:228640672-228640694 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922840504 1:228642913-228642935 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922841067 1:228645144-228645166 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
923699021 1:236282159-236282181 CGCCGCGGAGCCCGAGGCCTCGG - Intergenic
1063418236 10:5890296-5890318 CGGCGCGGGCCCGGCGGCGGCGG + Intronic
1067078995 10:43203219-43203241 AGGCTAGGGGCTGGAGGCATGGG - Intronic
1067346920 10:45443872-45443894 CGGGGCGGGGGAGGAGGCAGCGG - Intronic
1070301954 10:75210461-75210483 CGGCGCGTGGCCGGGGCGATAGG - Intronic
1070954176 10:80454007-80454029 CTGGGCGGTGCCGGAGGCTTGGG - Intergenic
1071579485 10:86756579-86756601 CGGCGCGGGTGCGGGGGCCTGGG - Intergenic
1073577840 10:104640577-104640599 CCGCGCGGGGGCGCAGGCCTTGG + Intergenic
1074165693 10:110872104-110872126 GGGGGCGGGGGCGGAGGCGTGGG + Intronic
1074503119 10:114043990-114044012 CGGCGCGGGGCCGGAGGCATGGG - Intergenic
1076908237 10:133373643-133373665 CCGCGCGGAGGCGGAGGCAACGG + Exonic
1077095226 11:796267-796289 AGGCGAGGGGCCGCAGGGATTGG + Exonic
1080515533 11:33016092-33016114 CGGCGCGGGGCGGGCGGCGTGGG + Intronic
1080540543 11:33259787-33259809 GGGCGGGGGGCGGGAGGCAGAGG - Intronic
1080887022 11:36376729-36376751 CTGGGAGGGGCCGGAGTCATAGG + Intronic
1081492533 11:43579417-43579439 CGGGGAGGGGCCGGAGGGAGCGG + Intronic
1083571369 11:63763737-63763759 CGGGGCGGGGGCGGAGGCGGGGG + Exonic
1084334090 11:68446820-68446842 CGTCGAGGGGCCGGGGGCTTGGG + Intronic
1085396285 11:76208724-76208746 CTGGGCGGGGCTGGAGGCCTGGG - Intronic
1089564633 11:119364219-119364241 CGTCGCGGGGCCCGAGGCGCCGG - Intronic
1091695488 12:2625458-2625480 CAGCGCAGGGCCGGAAGCACTGG - Intronic
1093958673 12:25250545-25250567 CGGCGCGGGGAGTGAGGAATGGG - Intronic
1098268323 12:68746096-68746118 CGGCTCGGGGGCGGAAGCACTGG + Exonic
1098275631 12:68808611-68808633 GGGCGCGGGGCGCGGGGCATGGG + Intronic
1101427416 12:104599358-104599380 CCGCGCGGTCCCGGAGCCATGGG + Intronic
1102888396 12:116538827-116538849 AGGGGCGGGGCTGGAGGCACAGG - Intergenic
1104854298 12:131894888-131894910 GGGCGCGGGGCCGGGGGCGCGGG - Exonic
1104977779 12:132559978-132560000 CGGCGCGGGCCCCGAGGCGGCGG - Intronic
1106157533 13:27171885-27171907 AGGCGCGGGCCCGGAGGCAGCGG - Exonic
1106602561 13:31200226-31200248 CGGCGCGGGGAGGGAGGCGCAGG + Intronic
1115120031 14:29927767-29927789 CGGCTCGGGGCCGCCGGCACTGG + Intronic
1117842161 14:59870832-59870854 CGCGGCGGGGCCGGAGGAAGAGG - Exonic
1117910950 14:60637782-60637804 CGACGCAGGGCCGGAGGCAGCGG + Intergenic
1118607600 14:67515086-67515108 CGGTGCGGGGCCGGGGCCGTGGG + Exonic
1119520157 14:75279142-75279164 CGCCGCGGGGCCGGGGGCTTGGG + Intronic
1119731335 14:76953251-76953273 CGGGGCAGGGCCAGTGGCATAGG + Intergenic
1121074925 14:91060230-91060252 GGGCGCGGGGCCGCAGCCGTGGG - Intronic
1121645750 14:95516423-95516445 CGGCGCGGGGGCGGGGGCCCCGG - Intronic
1121776180 14:96592675-96592697 CGGCGCGGGGCGGAGGGCAGGGG - Intergenic
1122274879 14:100586392-100586414 GGGAGCGGGGCCGGATGGATAGG - Intronic
1122823708 14:104359637-104359659 GGGCTGGGGGCCGGAGGCAGGGG - Intergenic
1124427039 15:29570926-29570948 CGGCGCGGCGGCGGCGGCATGGG - Intergenic
1125742014 15:41972105-41972127 CGGGGCGGGGCCGAGGGCACCGG + Intronic
1130967071 15:88705486-88705508 CGGCGCGCGGCGGGCGGGATTGG - Intergenic
1131257350 15:90871465-90871487 CCGCGCGGGGCCGGACGCGCTGG + Intronic
1131694078 15:94856411-94856433 GGGCGAGGGGCCGGAGGCTGGGG + Intergenic
1131694135 15:94856632-94856654 TGGCGCGGCGGCGGAGGCAGCGG + Intergenic
1132426791 15:101724499-101724521 TGGGGCGGGGACGGAGCCATGGG + Exonic
1132498843 16:275891-275913 CGGCGCGGGGCCGGCGGCCATGG + Exonic
1132544801 16:528120-528142 CGGCGGGGCGCAGGAGGCCTCGG + Intronic
1134849796 16:17470603-17470625 CGGCGCGGGGCCGGGGCCGGGGG + Exonic
1136233982 16:28903491-28903513 CGGGGCGGGGGCGGCGTCATGGG - Intronic
1136485582 16:30570009-30570031 GGCGGCGGGGCCGGAGGCCTGGG - Exonic
1136498426 16:30658119-30658141 AGACGCGGGGCCTGAGGCGTTGG - Intergenic
1136609210 16:31356055-31356077 CAGGGCAGGGCCGGGGGCATGGG - Intronic
1138472030 16:57245431-57245453 CGACTTGGGGCCGGAGGCAGCGG + Intronic
1138510864 16:57507802-57507824 CGGAGCGGGGCTGGAGGCAGCGG - Intergenic
1139966293 16:70747294-70747316 GGGCGTGGGGAGGGAGGCATGGG + Intronic
1142240181 16:88941383-88941405 CGGCGGGGGGCAGGAGGCGGAGG - Intronic
1142417036 16:89948820-89948842 CGGCGCGGGGCCGGCGGGGTCGG + Intronic
1142812287 17:2400997-2401019 GGCCGCGGGGCGGGAGGCATCGG - Exonic
1142967312 17:3589755-3589777 CGGTGCGGGGCTGATGGCATGGG - Intronic
1143031702 17:3971520-3971542 CGGGGAGGGGCAGGAGGCCTGGG + Intergenic
1143627959 17:8121815-8121837 GGGCGCGGCGCTGGAGGCCTCGG + Exonic
1144683006 17:17207248-17207270 GGGCACTGGGCCGGGGGCATAGG + Intronic
1144832964 17:18141950-18141972 TGGAGCGGGGCTGGAGGGATGGG - Intronic
1146057624 17:29589228-29589250 CTGTGCGGGGCCGGAGGGCTGGG - Intronic
1146182199 17:30705672-30705694 GGGCGCTGGGCCTGAGGCAAAGG + Intergenic
1147702723 17:42405972-42405994 CGGCGCGAGGCCGGGCGCAGTGG - Intronic
1147722731 17:42548649-42548671 GGGGGCGGGGCCGGTGGGATGGG + Intergenic
1147967396 17:44200340-44200362 CGGCTCGGGGGCGGGGGCAGCGG + Intergenic
1148664182 17:49362173-49362195 CAGCGCGGGGCGGGCGGCAGGGG + Intronic
1152132318 17:78484839-78484861 CGGGGCGGGGCCGGAGGGGAAGG - Intronic
1152403361 17:80082760-80082782 CGGCGGGGGCCCGGGGGCCTGGG - Intronic
1152433102 17:80260504-80260526 CTGCGCGGGGCCGGCGGCGGCGG + Intergenic
1152541914 17:80981135-80981157 GGGCGCGGGGGCGGGGGCACGGG - Intergenic
1153265175 18:3262381-3262403 GGGCGCGGGGCCGGAGGTGGAGG + Intronic
1160745392 19:708990-709012 CGGCGCGGGGGCGGCGGCACCGG - Intergenic
1160860868 19:1236832-1236854 GGGCGCGGGGGCGGCGGCCTGGG + Intronic
1161210222 19:3062055-3062077 GGGCGCCGGGCCGGAGGCACCGG + Intronic
1162976633 19:14210130-14210152 GGGCGCTGGGCCTGAGGCAAAGG - Intergenic
1166605833 19:44141809-44141831 CGGCGGGAGGCGGGGGGCATTGG + Intronic
1167158775 19:47754777-47754799 GGGCGAGGGGCCGGAGGCTGGGG + Exonic
1167504150 19:49862509-49862531 GGGCGCGGGGCAGGGGGCAGGGG + Intronic
1168102395 19:54148218-54148240 AGGCGGGGGGCCGGAGGGGTAGG - Exonic
1168105237 19:54162299-54162321 CGGGGCCGGGCCGGAGTCAGGGG + Intronic
1168339118 19:55613794-55613816 CGGCGGGGGGCCGGGGGCGCAGG - Exonic
926077254 2:9951511-9951533 CGGCGCGGGGCGGGGGGCGGGGG - Intergenic
927125991 2:20012702-20012724 CGGGGCGGGGCCCGAGGCCGCGG - Intergenic
929033667 2:37671695-37671717 CGGGGCGGGGCCGGCGGCGCGGG + Exonic
935237411 2:101150802-101150824 TGGAGCGGGGCCGGAGGGCTCGG - Intronic
936122695 2:109760427-109760449 CGGCGCAGGGCCGGGGGCGGCGG + Intergenic
936221998 2:110611046-110611068 CGGCGCAGGGCCGGGGGCGGTGG - Intergenic
938595549 2:132784041-132784063 TGGCTCTGGGCCGGAGGCAGGGG - Exonic
945869136 2:215207975-215207997 CTGCCCGGGGCCGGCGGCACTGG - Intergenic
946311194 2:218883523-218883545 CGGGGCGGGGCGGGAGGCCTGGG - Intronic
947860488 2:233354462-233354484 CGGGGCGGGGCCGGCGGGAGGGG - Intergenic
947909992 2:233794526-233794548 CGGCTCTGGGCAGGAGGCTTAGG + Intronic
948945710 2:241217997-241218019 AGGGGCGGGGCTGGGGGCATCGG + Intronic
1170017870 20:11802251-11802273 CGGGGGGGGGCGGGAGGCAGGGG - Intergenic
1170969880 20:21105958-21105980 CGGGGCGGGGTCGGGGGGATGGG + Intergenic
1170999103 20:21396155-21396177 CGGCGCGGGGACGGCGGCGGAGG + Exonic
1171011373 20:21510964-21510986 CTGCGCCGGGCCGGAGGCCTGGG - Intergenic
1172275026 20:33674574-33674596 CGTCGCGGGACCGGAGCCCTCGG - Intergenic
1172581327 20:36050877-36050899 CGGCCCGGGGCCGGAGGGCCTGG + Intergenic
1175960554 20:62634437-62634459 CGTCCCGGGGCCGGAGGCTGGGG - Intergenic
1176005574 20:62860945-62860967 CGGGGCCGGGGCGGAGGCAAAGG - Intronic
1176137524 20:63530688-63530710 CGGGGCGTGGCCGGAGGGCTGGG - Intronic
1178513814 21:33229866-33229888 AGGGGCGGGGCCGGAGCCAGGGG - Intergenic
1178534891 21:33403322-33403344 CCGCGCGGGGGCGGTGGCCTCGG + Exonic
1179457219 21:41507985-41508007 CCGGGCGGGGCAGGGGGCATCGG + Exonic
1179998236 21:44983828-44983850 CGTCACGGGGCCGGAGGCAGGGG + Intergenic
1181000795 22:19987021-19987043 TGGCCCGGGGTCGGAGGCAGAGG - Intronic
1181670523 22:24423793-24423815 CGGAGGGGGACCCGAGGCATCGG - Intronic
1182296252 22:29312393-29312415 CGGCGGGGGCCCCGAGGCGTGGG - Exonic
1182771739 22:32801559-32801581 GGGGGCGGGGCCGGGGGCAAGGG - Intronic
1182903912 22:33920611-33920633 GGGCGCGGGGCCGGGGGCGCGGG + Intronic
1184230786 22:43157288-43157310 CGGGGCGGGGCAGGAGGGAGGGG + Intronic
1184315927 22:43689212-43689234 GGGCGCAGGGCCGGAGGCAGGGG + Intronic
1184561953 22:45268638-45268660 GGGCGAGGGGCGGGAGGAATGGG - Intergenic
1184681090 22:46072353-46072375 CGGCGCGGGGCCGGGGAAGTGGG + Intronic
1185039627 22:48497609-48497631 GGGGGCGGGGCTGGAGGCCTGGG + Intronic
1185039670 22:48497726-48497748 GGGGGCGGGGCTGGAGGCCTGGG + Intronic
1185039713 22:48497843-48497865 GGGGGCGGGGCTGGAGGCCTGGG + Intronic
1185397481 22:50600471-50600493 CCGCGCGGGGCGGGAGGCCGAGG - Intronic
950421248 3:12901094-12901116 CGGCGGGTGGCCGTGGGCATGGG + Intronic
952883463 3:37999145-37999167 CGGGGCGGGGCCGGAGGGGGCGG + Intronic
952970897 3:38649590-38649612 CGGCGCGGGGCTCGGGGCACTGG + Exonic
954812396 3:53256117-53256139 CGGGGCGGGGCTGAAGGCCTGGG - Intergenic
956675019 3:71725278-71725300 CGGCTCGGGGGCGGCGGCAGCGG + Exonic
957556255 3:81767442-81767464 CGGCGCTCGTCCGGAGGCTTGGG + Intergenic
959067815 3:101676326-101676348 CGGGGAGGGGCCGGACGCCTGGG - Intronic
961028730 3:123584552-123584574 AGGTGCGGGGCCGGGGGCAGCGG - Intronic
961081564 3:124033044-124033066 CGGCGCGGGGCCGCTGGGACTGG + Intergenic
963133306 3:141877204-141877226 CGGCGCGGCGCCGGAAGCCGGGG + Intronic
966696309 3:182793611-182793633 CGGCGCGGGGAGTGAGGCAGTGG + Exonic
967924142 3:194633232-194633254 CGGCGCGGGGCCGGGGACCTGGG + Exonic
968545230 4:1194756-1194778 TGGCCCGGGGCCAGAGGCAGTGG + Intronic
970118189 4:12722710-12722732 TGGAGCGGGGCTGGAGGTATGGG - Intergenic
976360758 4:84175333-84175355 TGGCGGGGAGCAGGAGGCATGGG + Intergenic
976765224 4:88592243-88592265 CGGCGCGGGGACAGCGGCACGGG - Intronic
977616086 4:99088746-99088768 CCGCGCAGCGACGGAGGCATGGG + Exonic
982184187 4:152779716-152779738 GCGCGCGGGGCCAGAGGCACCGG - Exonic
985727392 5:1523510-1523532 CGGCGCCGAGACCGAGGCATCGG + Intronic
986733287 5:10650151-10650173 CGGGGCGGGGCCGCAGGGCTGGG + Exonic
994107356 5:95961891-95961913 GGGCGCGGGGCCGGAGGGTGGGG - Exonic
994197226 5:96935047-96935069 TGGCTCGGGGCTGGAGGCAATGG + Intronic
995849309 5:116528367-116528389 TGGGGCTGGGCAGGAGGCATTGG - Intronic
1001159591 5:169301168-169301190 CGGGGGGGGGCCGGAGGGGTGGG - Intergenic
1001841533 5:174880771-174880793 CTGCCCGGGGCCGGCGGCACCGG - Intergenic
1002182116 5:177436055-177436077 CGGAGCTGGGCGGGCGGCATGGG - Exonic
1002193839 5:177491908-177491930 CGCGGCGGGGGCGGAGGCCTGGG + Exonic
1002195187 5:177497386-177497408 GGGGGCGGGGGCGGAGGCAGGGG + Intronic
1002621976 5:180494476-180494498 CGGCGCGGAGGCGAAGGCAGCGG + Exonic
1002925810 6:1605106-1605128 CGGCGCCGGGCCGGAGACCTGGG + Intergenic
1005385258 6:25279343-25279365 CGGCGCGGGGCGGGGGGAGTAGG - Intronic
1006589057 6:35141102-35141124 CGGCGCAGGGCGGGAAGCGTGGG + Intronic
1006725578 6:36196997-36197019 CAGAGCGGGGGCGGGGGCATCGG + Intronic
1007327654 6:41073808-41073830 CGGCGCCGGGCCGGAGACCCGGG - Intronic
1008254101 6:49275713-49275735 TGGCGCGGGGCAGGAGGCTCAGG - Intergenic
1016328229 6:142927015-142927037 CGGCGCGGGGCGGGCGGCCAGGG + Intronic
1019208042 6:170378975-170378997 AGGGACGGGGCCGGAGCCATGGG + Intronic
1021761224 7:23904754-23904776 CGGCGTGGGGGCGGGGGGATTGG + Intergenic
1027151815 7:75738827-75738849 CGGCGCTGGGCTGGAGGCGGCGG - Exonic
1029423540 7:100483777-100483799 CGGCGCGGGGCCGTGGGGCTGGG - Intergenic
1031340860 7:120598574-120598596 GGGGGCGGGGCGGGTGGCATTGG + Intronic
1031456096 7:121981309-121981331 TAGCGTGGGGCCTGAGGCATTGG + Intronic
1032083174 7:128870008-128870030 CGCCGCCGGGCCGGGGGCTTCGG + Intronic
1034434713 7:151057922-151057944 CGGGGCGGGGCTGGAGGCTCAGG - Exonic
1034441212 7:151086852-151086874 CGGCGCGGGGCCCGGGGCCGGGG + Exonic
1035264945 7:157685327-157685349 CGGCGCGGGGCAGGAAGGTTCGG - Intronic
1041244870 8:55880202-55880224 AGACTCGGGGCCGGGGGCATCGG + Intronic
1045305011 8:100951308-100951330 CGGGGAGGGGCCGGGGGCCTCGG - Intronic
1049657404 8:143804881-143804903 CGGGGCGGGGCAGGGGGGATGGG + Intronic
1052904048 9:33817971-33817993 CGGCGGGGAGCCGGAGGCCTCGG - Intronic
1053055158 9:34989674-34989696 CGGCGCGGAGGCGGAGCCGTGGG + Exonic
1053135854 9:35649941-35649963 CGGCTCGGGGCCCGAGGCCTGGG + Exonic
1057922058 9:99105387-99105409 TGGCGCGGGGCCGGGGGCGCAGG + Intronic
1058023710 9:100117590-100117612 GGGCGGGGGGCCGGAGGCCCTGG - Intronic
1058413843 9:104764393-104764415 CGGCGCGGGGCCCCAGGTCTGGG - Intronic
1061961551 9:133991581-133991603 GGGCGCGGGGCGGGAGCCCTCGG - Intronic
1188811394 X:34657257-34657279 CGGCGCGGGGCCGGCGGCGAAGG - Exonic
1189002000 X:36957677-36957699 GGGCGCGGGGCCGGCGGCGAAGG + Intergenic
1189398949 X:40647346-40647368 CGGCGCGGGGCCCCAGGCCGGGG + Exonic
1190285308 X:48957476-48957498 CGCCGCGGCGCCGGGGGCATCGG + Exonic
1197335547 X:125205724-125205746 CACCGCGGGGCAGGAGGCCTGGG - Intergenic