ID: 1074503718

View in Genome Browser
Species Human (GRCh38)
Location 10:114048114-114048136
Sequence TCTTACATACTCATGGTCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074503718_1074503724 -8 Left 1074503718 10:114048114-114048136 CCCCCGACCATGAGTATGTAAGA No data
Right 1074503724 10:114048129-114048151 ATGTAAGATGCATTTTCTTAGGG No data
1074503718_1074503723 -9 Left 1074503718 10:114048114-114048136 CCCCCGACCATGAGTATGTAAGA No data
Right 1074503723 10:114048128-114048150 TATGTAAGATGCATTTTCTTAGG No data
1074503718_1074503725 -7 Left 1074503718 10:114048114-114048136 CCCCCGACCATGAGTATGTAAGA No data
Right 1074503725 10:114048130-114048152 TGTAAGATGCATTTTCTTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074503718 Original CRISPR TCTTACATACTCATGGTCGG GGG (reversed) Intergenic
No off target data available for this crispr