ID: 1074509445

View in Genome Browser
Species Human (GRCh38)
Location 10:114099439-114099461
Sequence CCTTCCTTCCCGAGGCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074509445_1074509451 -3 Left 1074509445 10:114099439-114099461 CCTCCCTGCCTCGGGAAGGAAGG No data
Right 1074509451 10:114099459-114099481 AGGCTTGCAGTGTCCAAACTGGG No data
1074509445_1074509450 -4 Left 1074509445 10:114099439-114099461 CCTCCCTGCCTCGGGAAGGAAGG No data
Right 1074509450 10:114099458-114099480 AAGGCTTGCAGTGTCCAAACTGG No data
1074509445_1074509455 13 Left 1074509445 10:114099439-114099461 CCTCCCTGCCTCGGGAAGGAAGG No data
Right 1074509455 10:114099475-114099497 AACTGGGTCTGACCTCTCAGGGG No data
1074509445_1074509453 11 Left 1074509445 10:114099439-114099461 CCTCCCTGCCTCGGGAAGGAAGG No data
Right 1074509453 10:114099473-114099495 CAAACTGGGTCTGACCTCTCAGG No data
1074509445_1074509454 12 Left 1074509445 10:114099439-114099461 CCTCCCTGCCTCGGGAAGGAAGG No data
Right 1074509454 10:114099474-114099496 AAACTGGGTCTGACCTCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074509445 Original CRISPR CCTTCCTTCCCGAGGCAGGG AGG (reversed) Intergenic
No off target data available for this crispr