ID: 1074512075

View in Genome Browser
Species Human (GRCh38)
Location 10:114122650-114122672
Sequence CCATATATTCAGAGGGCAGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 238}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074512066_1074512075 4 Left 1074512066 10:114122623-114122645 CCTTTTCCAGATACCCCATTCTC 0: 1
1: 0
2: 0
3: 41
4: 273
Right 1074512075 10:114122650-114122672 CCATATATTCAGAGGGCAGAAGG 0: 1
1: 0
2: 2
3: 30
4: 238
1074512067_1074512075 -2 Left 1074512067 10:114122629-114122651 CCAGATACCCCATTCTCCTCACC 0: 1
1: 0
2: 3
3: 22
4: 255
Right 1074512075 10:114122650-114122672 CCATATATTCAGAGGGCAGAAGG 0: 1
1: 0
2: 2
3: 30
4: 238
1074512065_1074512075 16 Left 1074512065 10:114122611-114122633 CCAGATCATTTTCCTTTTCCAGA 0: 1
1: 1
2: 4
3: 59
4: 514
Right 1074512075 10:114122650-114122672 CCATATATTCAGAGGGCAGAAGG 0: 1
1: 0
2: 2
3: 30
4: 238
1074512068_1074512075 -9 Left 1074512068 10:114122636-114122658 CCCCATTCTCCTCACCATATATT 0: 1
1: 0
2: 2
3: 29
4: 421
Right 1074512075 10:114122650-114122672 CCATATATTCAGAGGGCAGAAGG 0: 1
1: 0
2: 2
3: 30
4: 238
1074512069_1074512075 -10 Left 1074512069 10:114122637-114122659 CCCATTCTCCTCACCATATATTC 0: 1
1: 0
2: 0
3: 21
4: 221
Right 1074512075 10:114122650-114122672 CCATATATTCAGAGGGCAGAAGG 0: 1
1: 0
2: 2
3: 30
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074512075 Original CRISPR CCATATATTCAGAGGGCAGA AGG Exonic
900482838 1:2907673-2907695 CCAGATGCTCAGAGGGGAGATGG + Intergenic
901128652 1:6948252-6948274 CCATATATGAAGATGGCAGCTGG - Intronic
902417906 1:16252795-16252817 TCATATTTTCAAAGGGGAGAGGG - Intronic
903293558 1:22329692-22329714 CCATTTACCCAGAGGGCACAAGG - Intergenic
904128433 1:28259053-28259075 CCAGATATTTAGAGGTCAGAGGG - Intergenic
904811684 1:33167251-33167273 AAATATATTCAGACAGCAGAAGG - Intronic
905966561 1:42103377-42103399 CCATATATTCAGAGTGCTTTGGG - Intergenic
906158911 1:43632654-43632676 CCATGTATACAGAGGGCCAACGG - Intergenic
906166972 1:43693819-43693841 CCACATACTCAGAGGAGAGACGG + Intronic
906381758 1:45336943-45336965 GCAGATCTTCAGAGGGCAAAGGG + Intronic
907621574 1:55986366-55986388 CCATGAATTCAGAGGACAAAGGG - Intergenic
908057025 1:60298812-60298834 CCAGATACTCAGGGGGCTGAGGG - Intergenic
908513896 1:64873060-64873082 CCTTATGTGCAGAGGTCAGAGGG - Intronic
908584817 1:65556141-65556163 CCATGTCTTCACATGGCAGAAGG - Intronic
910218707 1:84867369-84867391 CCAGAGATTCAGTCGGCAGAGGG + Intronic
911543650 1:99189324-99189346 CAATATATTCAGTGGGTAAAAGG - Intergenic
914903660 1:151726861-151726883 CCATGAATTCAAGGGGCAGAGGG - Intronic
916660433 1:166918511-166918533 CAATCTAATCAGAGTGCAGAGGG + Exonic
917073341 1:171177088-171177110 GCAAATCTTCAGAGAGCAGAGGG - Intergenic
918343766 1:183588962-183588984 CCACACATTCTGAGGGCTGATGG - Intronic
918612200 1:186505825-186505847 CAATATATTCAGAGTGCTGAAGG - Intergenic
918672166 1:187231375-187231397 GCATATATTTATAGGGCATATGG - Intergenic
919069911 1:192741205-192741227 CAATAGATTCAAAGTGCAGAAGG - Intergenic
923061647 1:230481001-230481023 CCAGATACTCAGAAGGCTGAGGG - Intergenic
1064176750 10:13081800-13081822 GCATTTATTTAGAGTGCAGATGG - Intronic
1064183465 10:13139844-13139866 TAATATATTCACAGTGCAGAAGG - Intergenic
1064289339 10:14019487-14019509 CAATATATTCAGTAGACAGAGGG + Intronic
1066174417 10:32888650-32888672 CCATACATTGAGAGGGCTGCTGG - Intergenic
1066313437 10:34220545-34220567 CCCCCTATTCAGAGGGCTGAAGG - Intronic
1068329414 10:55542325-55542347 ACATATATTCAAGGGGCATAGGG - Intronic
1069464449 10:68625967-68625989 CCATCTACTCAGAAGGCTGAGGG + Intronic
1072746984 10:97947320-97947342 CCAAGCTTTCAGAGGGCAGAGGG + Intronic
1073298931 10:102458896-102458918 CTATATAATCAGAGGGTTGAGGG + Intergenic
1074324246 10:112432465-112432487 TCCTTTATTCAGAGGGCAGCAGG + Exonic
1074512075 10:114122650-114122672 CCATATATTCAGAGGGCAGAAGG + Exonic
1077579534 11:3407903-3407925 CCATAAATCCAGAGGGCAGGTGG - Intergenic
1077843436 11:5999279-5999301 CCTATTATTCAGAGGGCAGCAGG + Intergenic
1079750371 11:24189745-24189767 ACATCTATTCAGTGGGCAGTCGG - Intergenic
1083168674 11:60908648-60908670 GCAAATCTTTAGAGGGCAGAGGG - Intergenic
1083923823 11:65794170-65794192 CCATGTCTTCAGAGGGCAGCTGG - Exonic
1084236559 11:67791441-67791463 CCATAAATCCAGAGGGCAGGTGG - Intergenic
1084302732 11:68261985-68262007 CCATATACCCAGAGGGCCGCTGG - Exonic
1084670589 11:70604403-70604425 CCAACCATTCAGAGGGCAGAGGG - Intronic
1084835867 11:71801552-71801574 CCATAAATCCAGAGGGCAGGTGG + Intergenic
1085020419 11:73203567-73203589 GCAAATATTTAGAGGGCAAAGGG - Intergenic
1086532583 11:87803285-87803307 ACACATACTCAGAGGGAAGATGG - Intergenic
1086606151 11:88698948-88698970 CCATATAGCTAGAGAGCAGATGG - Intronic
1087464362 11:98486289-98486311 CCATAGATACAGAGGGCTAATGG - Intergenic
1089564359 11:119363285-119363307 CCATTTATGCAGCGGGCAGCGGG - Intronic
1091414558 12:270080-270102 ATCTATATTCAGGGGGCAGATGG - Intergenic
1092395091 12:8118914-8118936 CCATGTCTTCACATGGCAGAAGG - Intergenic
1092407458 12:8230851-8230873 CCATAAATCCAGAGGGCAGGTGG - Intergenic
1093056408 12:14560354-14560376 TAATATATTCAGAAGTCAGAGGG + Intronic
1093604741 12:21076211-21076233 CCCTATATTCATAGGGAAGAAGG - Intronic
1093912687 12:24765109-24765131 GCATATATTTAGATGGAAGATGG + Intergenic
1102068452 12:109998392-109998414 GCATACACTCAGAGGGCAGAGGG + Intergenic
1102250924 12:111387050-111387072 CCATAGAGACAGAGAGCAGATGG - Intergenic
1102753128 12:115313582-115313604 CCATATACTAAGAGGGTAGTAGG - Intergenic
1103192877 12:119017471-119017493 GCATATACTAAGCGGGCAGATGG + Intronic
1104892089 12:132144943-132144965 CCATCTCCTCAGAGGGCAGCTGG - Exonic
1105284900 13:18995748-18995770 CCAGATATTCAGAAGGCAGAAGG + Intergenic
1105433864 13:20360820-20360842 CCTTATGTTCAGGAGGCAGATGG + Intergenic
1106051846 13:26197851-26197873 CCATATGATCAGAGAACAGACGG - Intronic
1106158848 13:27182962-27182984 CCCTTTATTCAGAAGGCAGCAGG - Intergenic
1106374879 13:29176603-29176625 CCATATCTTCAGATGGTGGAAGG + Intronic
1109488596 13:63063455-63063477 GAATATACTCACAGGGCAGAAGG - Intergenic
1110202056 13:72863229-72863251 CCATAAATTAAGATGGAAGAAGG + Intronic
1110467192 13:75815325-75815347 AGATATATTTAGAAGGCAGAGGG + Intronic
1111211206 13:85082586-85082608 CCATATACTCAGATGCCTGATGG - Intergenic
1111287049 13:86108234-86108256 TGATATATTCAGAATGCAGACGG - Intergenic
1112452814 13:99527191-99527213 ACTAATATTCAGAGGGTAGAGGG + Intronic
1113695839 13:112344730-112344752 CCATTGATTCAGAAGGCAGAGGG - Intergenic
1115616139 14:35096557-35096579 CCATAAACTCTTAGGGCAGAAGG + Exonic
1115789824 14:36866223-36866245 CCAGCTAGTCAGAGGGCTGAGGG - Intronic
1115964910 14:38877203-38877225 CCAGCTACTCAGAAGGCAGAAGG + Intergenic
1116605442 14:46987475-46987497 TCCTTTATGCAGAGGGCAGAAGG + Intronic
1117124586 14:52608726-52608748 TGATATATTCAGAGTGCTGATGG - Intronic
1117732081 14:58733222-58733244 CCATATCCTCACATGGCAGAAGG + Intergenic
1120015657 14:79470430-79470452 CCATGTTTTCACATGGCAGAAGG + Intronic
1120039854 14:79739976-79739998 GGACATATTCAGAGGGCAGCTGG - Intronic
1120182222 14:81355481-81355503 TGATATATTCAAAGTGCAGAAGG + Intronic
1120877949 14:89392069-89392091 CCATAAAGTTAGGGGGCAGATGG - Intronic
1121702269 14:95963546-95963568 CAGTTTATACAGAGGGCAGATGG + Intergenic
1121917313 14:97847545-97847567 CCAGCTACTCAGAGGGCTGAGGG - Intergenic
1122414066 14:101540477-101540499 CCAAATACCCAGTGGGCAGAGGG + Intergenic
1202905762 14_GL000194v1_random:71741-71763 CAACATATTCAGATGGCAGCGGG - Intergenic
1202917314 14_GL000194v1_random:188231-188253 TCATACCTTCAGAGGGTAGAGGG - Intergenic
1125454831 15:39846433-39846455 CCATATCAACAGAGGCCAGATGG + Intronic
1126275233 15:46870703-46870725 TCATATATTTATAGGGCAAAAGG + Intergenic
1126806506 15:52354737-52354759 CCATCTACTCAGGAGGCAGAGGG + Intronic
1127440761 15:59004983-59005005 GCATATAATCAGTGAGCAGAAGG + Intronic
1128075176 15:64821342-64821364 CAGTATGTTCAGAGGGCAGCAGG - Intronic
1129426314 15:75465789-75465811 CCTTAAATTCACAGGGCAGTCGG + Exonic
1133348152 16:5083963-5083985 CCATAAATCCAGAGGGCAGGTGG - Intronic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1135902522 16:26476245-26476267 CCAGCTACTCAGGGGGCAGATGG - Intergenic
1139276072 16:65728724-65728746 CCAGATTCTCAGAGGGCAGGGGG - Intergenic
1140012592 16:71151158-71151180 CCATATAACCAAAGGGTAGAAGG - Intronic
1144647108 17:16982557-16982579 CAATATATTCAGATGGAATAAGG + Intergenic
1146018350 17:29251594-29251616 CCAGCTATTCAGGGGGCTGAGGG - Intronic
1146929556 17:36767889-36767911 CCATTCATTCATAAGGCAGAGGG - Intergenic
1148049975 17:44765152-44765174 CCATTTATCAAGAGGGCAGCGGG - Intronic
1148402070 17:47372732-47372754 CTATATATTCAGAGTACTGAAGG - Intronic
1148720020 17:49745121-49745143 CCACAGATACAGAGGGCTGATGG + Intronic
1150193363 17:63267317-63267339 CCAGACATTCAGAGGCAAGATGG + Intronic
1151519512 17:74618076-74618098 CCATGCATTCAGAGGAAAGAGGG + Intronic
1152696659 17:81800932-81800954 ACATATAAACAGAGGGCAGCTGG - Intergenic
1153300337 18:3586571-3586593 CCACCTATTCAGCAGGCAGAGGG - Intronic
1154402638 18:14056243-14056265 CCATATATTAATAGGGCTGTTGG + Intergenic
1155236596 18:23826053-23826075 ACATATCTGCAGAGGGAAGAGGG - Intronic
1156432079 18:37085871-37085893 AGATATATTGAGAGGACAGAAGG - Intronic
1156792823 18:40997943-40997965 TTATATATTCAAAGTGCAGAAGG + Intergenic
1157298909 18:46465649-46465671 TCCTAAATTCAGAAGGCAGAAGG - Intergenic
1157932137 18:51834761-51834783 CCCTATATGAAGAGGGCAAAAGG - Intergenic
1164189173 19:22899583-22899605 CCACATCTTCAGAGTGCAGTGGG - Intergenic
925974476 2:9132088-9132110 GCAAACATTCAGAGGGCAAAGGG - Intergenic
926008118 2:9388559-9388581 CTATATATTCACAGGGATGACGG - Intronic
926109949 2:10175709-10175731 CCAGCTACTCAGAGGGCTGATGG - Intronic
930522239 2:52482034-52482056 CCATAGAGGCAGAGGGTAGAAGG + Intergenic
931819076 2:65933531-65933553 CTCTATATTCAGAGGGCTAATGG - Intergenic
933293803 2:80467814-80467836 CTATATTTTCACATGGCAGAAGG - Intronic
933440859 2:82311944-82311966 ACATATACTCACAGGGCTGAAGG + Intergenic
933636998 2:84719623-84719645 CCAGATATTCAGGGGGCTGAGGG - Intronic
933811846 2:86037442-86037464 CCATAAGGTGAGAGGGCAGAGGG + Intronic
934139940 2:89036560-89036582 CCATTTATTCATGGGGCACATGG + Intergenic
934229300 2:90163991-90164013 CCATTTATTCATGGGGCACATGG - Intergenic
935550572 2:104449160-104449182 CCATAGATTCAGAAGCCAAAGGG + Intergenic
935602435 2:104936757-104936779 CCTTTTTTTCACAGGGCAGAAGG - Intergenic
935980291 2:108619811-108619833 CAATATATTCAAAGTTCAGAAGG + Intronic
936711751 2:115139878-115139900 CCAAACAGTCATAGGGCAGAAGG + Intronic
937393546 2:121514457-121514479 CCATATATTCAAAGACCAGAAGG + Intronic
938980483 2:136521611-136521633 CCAAATATTCAGAAATCAGAAGG - Intergenic
939201968 2:139047328-139047350 CCATATAATCAGAGTGGAGTGGG + Intergenic
940176089 2:150878939-150878961 CCATATATGCAGAGTGGGGAGGG + Intergenic
941599795 2:167528326-167528348 CCAGATATTCAGAGGCCAAAGGG - Intergenic
942868302 2:180703338-180703360 CCAGCTATTCAGAAGGCTGAAGG - Intergenic
1169292821 20:4367268-4367290 TCACATGTTCAGAGAGCAGAGGG - Intergenic
1169408694 20:5348607-5348629 GCACATACACAGAGGGCAGATGG + Intergenic
1171079753 20:22166792-22166814 CCACACATTCAGAAGGCACAGGG - Intergenic
1171112172 20:22494348-22494370 CCTTATATTTAGAGGGCCAAGGG - Intergenic
1171475591 20:25406349-25406371 CCAGCTACTCAGAGGGCTGAGGG + Intergenic
1171517292 20:25747612-25747634 GCAGATATTCAGAGGGTAGGAGG + Intergenic
1172490595 20:35333733-35333755 CAATATTTTAAGAGTGCAGAAGG + Intronic
1174553275 20:51376476-51376498 CCATCTTTACAGAGGGTAGAGGG + Intergenic
1176636762 21:9252333-9252355 TCATACCTTCAGAGGGTAGAGGG + Intergenic
1176874336 21:14113829-14113851 GCACATCTTCACAGGGCAGAAGG + Intronic
1177504772 21:22006235-22006257 CCATATCCTCATATGGCAGAAGG + Intergenic
1180049475 21:45324744-45324766 CCAGAAATTCCCAGGGCAGAAGG + Intergenic
1183309898 22:37103681-37103703 CCCTATGGTCAGAGGACAGACGG + Intronic
1183650045 22:39148598-39148620 CCGAATATTCTGAGGGCTGAAGG - Intronic
1185073676 22:48670976-48670998 CCATAAATTTGGAGGCCAGAGGG + Intronic
1185240111 22:49737806-49737828 CCACATATACAGAGAGGAGAGGG + Intergenic
950663804 3:14482779-14482801 CTATTTTTTCAGAGGACAGAGGG + Intronic
951772356 3:26272537-26272559 GCAAACCTTCAGAGGGCAGAGGG + Intergenic
956341482 3:68229027-68229049 CCATATTTGGAGGGGGCAGATGG - Intronic
956978635 3:74611907-74611929 GAATATATTCAGATGGCAGGAGG - Intergenic
957052503 3:75421225-75421247 CCATAAATCCAGAGGGCAGGTGG - Intergenic
957103998 3:75862932-75862954 TCATACCTTCAGAGGGTAGAGGG - Intergenic
957284548 3:78201564-78201586 TCATAGAAACAGAGGGCAGAAGG + Intergenic
957935840 3:86941106-86941128 ACATATATTTAAAGGGAAGATGG - Exonic
958552768 3:95637707-95637729 CCATATCTTATGTGGGCAGAGGG + Intergenic
959145842 3:102543473-102543495 CCATATATAAAGAGAGAAGATGG - Intergenic
959696457 3:109253883-109253905 CCAAATGTTCAGAAGGCACAGGG + Intergenic
959906189 3:111713320-111713342 CCATAGATTATGAGGGCAGGCGG + Intronic
961156851 3:124686928-124686950 CCAGATATTCAGGAGGCTGAGGG - Intronic
961302340 3:125930329-125930351 CCATAAATCCAGAGGGCAGGTGG + Intronic
961886119 3:130097456-130097478 CCATAAATCTAGAGGGCAGGTGG - Intronic
962375156 3:134852964-134852986 CCATACTGTCAGAGGGCAGGTGG + Intronic
964247372 3:154669248-154669270 CCATATATTGTGAAGGCAGGAGG + Intergenic
964247561 3:154670801-154670823 CCATATATTGTGAAGGCAGGTGG + Intergenic
965635780 3:170778994-170779016 CCATGGATGCAGAGGGCTGATGG + Intronic
967308395 3:188082252-188082274 GCAGATGTTCAGAGGTCAGATGG + Intergenic
967508755 3:190285741-190285763 CAATATATTCAGAGTTCTGAGGG - Intergenic
967600234 3:191378182-191378204 CCAAATATTTAGAGGGGAAATGG - Intronic
1202750133 3_GL000221v1_random:152686-152708 TCATACCTTCAGAGGGTAGAGGG - Intergenic
968995311 4:3941607-3941629 CCATAAATCCAGCGGGCAGGCGG - Intergenic
969758683 4:9167193-9167215 CCATAAATCCAGAGGGCAGGTGG + Intergenic
969818647 4:9704656-9704678 CCATAAATCCAGAGGGCAGGAGG + Intergenic
973843488 4:54886973-54886995 TAATATATTCAGAGGTCAAAGGG + Intergenic
976399111 4:84587658-84587680 GCAAGTCTTCAGAGGGCAGAGGG - Intronic
979066258 4:116137687-116137709 TCATATAAGCAGAGAGCAGAAGG - Intergenic
979556290 4:122051278-122051300 CCAATTATTAAGATGGCAGAAGG - Intergenic
980650655 4:135711089-135711111 GCATCTCTTCAGAGGGCAGCAGG - Intergenic
981903861 4:149896832-149896854 CCAGAAATGCAGAGGGGAGAGGG + Intergenic
982527490 4:156497752-156497774 CCAGGTCTTCAGATGGCAGAAGG + Intergenic
983527071 4:168770340-168770362 CCAGCTATTCTCAGGGCAGAGGG - Intronic
983911327 4:173242781-173242803 CCAGAAATTCAGAGGGAACAAGG - Intronic
984745756 4:183215030-183215052 CCCTTTATTCATAGGGCATATGG + Intronic
1202751650 4_GL000008v2_random:10775-10797 TCATACCTTCAGAGGGTAGAGGG + Intergenic
987246348 5:16053095-16053117 CCTTTTACTCAGAAGGCAGAAGG + Intergenic
987910471 5:24137240-24137262 CCATATCCTCATAGGGCAGAGGG - Intronic
988412646 5:30907155-30907177 CTATATCTTCAAATGGCAGAAGG + Intergenic
991235765 5:64395098-64395120 CCATATTTACAGATGGCACATGG + Intergenic
991277411 5:64865626-64865648 CCTTATTTTTAGAGGGAAGATGG + Intronic
991420762 5:66439023-66439045 CCATATGCTCAGAGAGCTGAAGG + Intergenic
993120101 5:83764686-83764708 CTATATCTTCACATGGCAGAGGG + Intergenic
993225912 5:85167146-85167168 CCATGGCTTCAGAGGGCACAAGG + Intergenic
993426092 5:87765870-87765892 AAATATAATCAGAGGTCAGAAGG + Intergenic
995124220 5:108564011-108564033 CTACATACTAAGAGGGCAGAAGG + Intergenic
997620849 5:135292717-135292739 CAATATCTGCAGAAGGCAGATGG + Intronic
997685699 5:135786226-135786248 TCGTATATTCAGAGGGGAGAGGG + Intergenic
1001794429 5:174490286-174490308 CCATAAATGCAGAAGGCAGCTGG + Intergenic
1005436550 6:25817995-25818017 CAATATATACAGTGAGCAGATGG - Intronic
1005787500 6:29260881-29260903 TCTTATGTACAGAGGGCAGATGG + Intergenic
1007033062 6:38646654-38646676 GCACAGCTTCAGAGGGCAGAGGG - Intergenic
1007883270 6:45191398-45191420 CCAGAAATTCAGAGGGAAGGAGG + Intronic
1008454008 6:51687497-51687519 CCATCTATTCAGTGGCCAGCAGG + Intronic
1009162698 6:60303010-60303032 CCACACATTCAGAGGGAACATGG - Intergenic
1010398615 6:75422398-75422420 CCTTTTCTTCAGAGGCCAGATGG - Intronic
1011103809 6:83756736-83756758 CAATATATTCAGAGTGCTGAAGG - Intergenic
1011804652 6:91058674-91058696 CAATATATTCAGAATGCAAAAGG - Intergenic
1011815045 6:91179590-91179612 CCATGTAGTCAGAGAGCACAAGG - Intergenic
1011876625 6:91970629-91970651 CCATATATAGAGAGGGAAAAGGG + Intergenic
1011900381 6:92287390-92287412 CCACATATTCTGAGAGCACATGG - Intergenic
1013676889 6:112474622-112474644 CCATGGATTCGGAGGGCTGACGG + Intergenic
1016155890 6:140808417-140808439 CCATTTTTTGAAAGGGCAGAGGG + Intergenic
1017558278 6:155598004-155598026 ACACATATACAGAGGGCAGCTGG + Intergenic
1018916222 6:168134179-168134201 CCATGTGTCCAGAGGACAGATGG - Intergenic
1020319584 7:6929924-6929946 CCATAAATCCAGAGGGCAGGTGG - Intergenic
1021220796 7:17973420-17973442 CAATAAATTGAGAGTGCAGATGG - Intergenic
1021507054 7:21397468-21397490 GCAAATCTTTAGAGGGCAGAGGG - Intergenic
1025263282 7:57437242-57437264 CCATATATTTGGAGGACAGGAGG - Intergenic
1029256304 7:99271996-99272018 CCATATAAAAAGAGGGAAGATGG - Intergenic
1029496914 7:100900517-100900539 CCAGCTATTCAGAAGGCTGAAGG - Intergenic
1034711011 7:153191535-153191557 TCATCTACCCAGAGGGCAGAGGG - Intergenic
1034778203 7:153851180-153851202 CCAAATAGTCAAAGGGCAAATGG - Intergenic
1034909085 7:154977755-154977777 ACATATATTAAAAGGGCAAAGGG + Intronic
1036494487 8:9257595-9257617 CCATGAATTCACAGGACAGAAGG + Intergenic
1036847834 8:12181770-12181792 CCATAAATCCAGAGGGCAGGTGG - Intergenic
1036869202 8:12424085-12424107 CCATAAATCCAGAGGGCAGGTGG - Intergenic
1038039860 8:23715415-23715437 CCCTATATTCAGTGGGCACAAGG - Intergenic
1038073300 8:24042429-24042451 ACATATTTCCAGAAGGCAGAAGG - Intergenic
1038648116 8:29378244-29378266 GCAAATCTTCAGAGGGCAAAGGG - Intergenic
1039263082 8:35794206-35794228 ACACATTTACAGAGGGCAGAGGG - Intronic
1043611736 8:82072585-82072607 CTATATACTCAGAAGGCAAAGGG - Intergenic
1045548838 8:103152302-103152324 CCATGTATTCAGAGAACAGAGGG - Intronic
1046393089 8:113602486-113602508 CCATATATGCAGAGAGCAGAAGG - Intronic
1046707916 8:117476818-117476840 CCAAATATTCAGAAGACAGATGG - Intergenic
1047627393 8:126670035-126670057 TCATTGATTCAGAAGGCAGAGGG - Intergenic
1048277604 8:133078801-133078823 ACCTATATTCAGAGGACAGACGG + Intronic
1048864303 8:138748226-138748248 ACAGATGTTCAGAGGACAGAGGG - Intronic
1049149615 8:141026224-141026246 ACACATATTCACAGGGCAGAAGG + Intergenic
1051535960 9:18158090-18158112 CCATTTATACAGAGAGCAGGAGG - Intergenic
1052087801 9:24289947-24289969 GCAAACCTTCAGAGGGCAGAAGG - Intergenic
1052238653 9:26245718-26245740 CCACATATTCAGAGGGAGGCTGG - Intergenic
1054850234 9:69839960-69839982 CCAGCTATTCAGAGGGTTGAGGG + Intronic
1055078161 9:72238268-72238290 CCATATAAACAGAGGCCAAAAGG - Intronic
1056597616 9:88020625-88020647 GCAAATCTTCAGAGGGCAAAGGG + Intergenic
1056991591 9:91417230-91417252 CAATACATTCAGAGAGTAGAGGG - Intronic
1058519338 9:105803293-105803315 CCTAATATCCAGAGGGGAGAAGG - Intergenic
1061903681 9:133685685-133685707 CCAACTCTTCAGAGGCCAGAGGG + Intronic
1203498124 Un_GL000224v1:172287-172309 ACAAATATTCAGAGGACAGTAGG + Intergenic
1203510678 Un_KI270741v1:114537-114559 ACAAATATTCAGAGGACAGTAGG + Intergenic
1203718775 Un_KI270742v1:182776-182798 TCATACCTTCAGAGGGTAGAGGG - Intergenic
1203653003 Un_KI270751v1:146450-146472 TCATACCTTCAGAGGGTAGAGGG - Intergenic
1186314963 X:8359318-8359340 CTGTATCTTCACAGGGCAGAAGG - Intergenic
1188629004 X:32327418-32327440 TTATTTATTCAGAGGTCAGATGG - Intronic
1190312409 X:49125941-49125963 CCAGCTACTCAGAGGGCTGAGGG + Intergenic
1190782802 X:53614669-53614691 CCATCAATCCAGAAGGCAGATGG - Exonic
1192681119 X:73254916-73254938 CCATCTATAAAGAGGGGAGAAGG + Intergenic
1193296293 X:79835749-79835771 TCAAATAATTAGAGGGCAGAAGG - Intergenic
1195054398 X:101129254-101129276 CCATATATGCTGATAGCAGAGGG - Intronic
1195839528 X:109157749-109157771 CCATCTCTTCACAGGGCAGCAGG + Intergenic
1196862910 X:120044247-120044269 GAAGATATTCAGTGGGCAGAAGG + Intergenic
1196880192 X:120192097-120192119 GAAGATATTCAGTGGGCAGAAGG - Intergenic
1197263777 X:124344889-124344911 CCATATATTGAGCAGGCAAATGG - Intronic
1199672010 X:150155466-150155488 CCATCTACTCTTAGGGCAGAAGG - Intergenic
1201277029 Y:12308511-12308533 CCACATATTCAGAGGACTGTGGG - Intergenic
1202254761 Y:22909422-22909444 CCTTCTATTCAGAGGGATGATGG + Intergenic
1202407752 Y:24543171-24543193 CCTTCTATTCAGAGGGATGATGG + Intergenic
1202463029 Y:25126910-25126932 CCTTCTATTCAGAGGGATGATGG - Intergenic