ID: 1074513098

View in Genome Browser
Species Human (GRCh38)
Location 10:114137374-114137396
Sequence GTCCTAGCACTGTCACTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 138}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074513095_1074513098 -2 Left 1074513095 10:114137353-114137375 CCGGCAAGTAGGAAGGTTCTTGT 0: 1
1: 0
2: 1
3: 5
4: 116
Right 1074513098 10:114137374-114137396 GTCCTAGCACTGTCACTGAGGGG 0: 1
1: 0
2: 1
3: 11
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074513098 Original CRISPR GTCCTAGCACTGTCACTGAG GGG Intronic
901149825 1:7093803-7093825 GTCCTGGCTCCGTCACTCAGTGG + Intronic
905801959 1:40849970-40849992 GTCCTGGCTCTGTCACTTACTGG - Intergenic
906163873 1:43671368-43671390 ATCCTGGCTCTGTCACTGAGGGG - Intronic
907125831 1:52050041-52050063 GTCCCAGCTCTGCCACTTAGTGG - Intronic
909494133 1:76259361-76259383 ATCCTGGTTCTGTCACTGAGTGG + Intronic
910204889 1:84740120-84740142 GTTCTTGCACTGACACTGATAGG + Intergenic
912962438 1:114208126-114208148 GTCCTCTCACTGTCCCTCAGAGG - Intergenic
917003366 1:170385432-170385454 GTACCAGCACAGTCACAGAGTGG - Intergenic
918952362 1:191155115-191155137 GTCAAAGCACTGTAACTGAATGG - Intergenic
919280715 1:195485488-195485510 GTCCCAGCCCTGGCACAGAGGGG + Intergenic
921309079 1:213824996-213825018 GGCCTAGCACTGCCAGGGAGGGG - Intergenic
1063153164 10:3355065-3355087 GTCCTTGCTCTGTCACTCACAGG - Intergenic
1063437688 10:6047989-6048011 GTCCTAGCTCCACCACTGAGGGG - Intronic
1064250941 10:13705986-13706008 GTCCAAGCCCTCTCACTGGGCGG + Intronic
1070411857 10:76149361-76149383 GTCCTAGCTCTGTAAGTGATTGG + Intronic
1070689035 10:78511174-78511196 GTCCTGGCTCTGCCACTTAGAGG - Intergenic
1073189277 10:101639195-101639217 GGCCTAGCACCCTCCCTGAGGGG - Intronic
1074350199 10:112729156-112729178 GCCACAGCACTGTCACTGAAAGG + Intronic
1074513098 10:114137374-114137396 GTCCTAGCACTGTCACTGAGGGG + Intronic
1075103850 10:119524345-119524367 GTCCTAGCTCTGCCACGGTGCGG + Intronic
1075306732 10:121374637-121374659 ATCCTAGCTCTGCCACTGTGAGG - Intergenic
1076249286 10:128972579-128972601 GCCTCAGCACTGTCACTGGGAGG + Intergenic
1077474551 11:2780215-2780237 GTCCTTGCCCTGCCACTGACTGG + Intronic
1084997334 11:72994088-72994110 GTCCTAGACCTGTCACTTGGAGG + Intronic
1086492363 11:87368428-87368450 GTCCTGGCTTTGTCACTTAGGGG + Intergenic
1087355034 11:97082186-97082208 GTCCTAGCACCTTCAATGAAAGG - Intergenic
1089442683 11:118530418-118530440 GTCCCAGCTCTGCCACTAAGTGG + Intronic
1089459302 11:118643455-118643477 GTCCTAGCTCTGCCACTAACAGG - Intronic
1091914548 12:4260943-4260965 GTCCCAGCTCTGTCACTAAAAGG + Intergenic
1094569620 12:31630180-31630202 GTCCCAGCTCTGTCACTCACTGG - Intergenic
1100704664 12:97186960-97186982 TTCCCAGCCCTGGCACTGAGAGG + Intergenic
1102783607 12:115585853-115585875 CTCCTAGCTTTCTCACTGAGAGG - Intergenic
1103703815 12:122860962-122860984 GTTCTCGCACAGTCAATGAGAGG + Exonic
1105883856 13:24625960-24625982 GTGCTTGCACTGGCACTGTGGGG - Intergenic
1108421206 13:50251578-50251600 GTCAGAGAAGTGTCACTGAGTGG - Intronic
1109331144 13:60932341-60932363 CTCCCAGCACTCTCACAGAGCGG - Intergenic
1109348980 13:61152490-61152512 GTCCTAACACTGTCACATTGTGG - Intergenic
1110348778 13:74481336-74481358 GTCCTAACACTGCCACATAGGGG + Intergenic
1112926715 13:104684352-104684374 GTCCTACCTCTATCGCTGAGAGG + Intergenic
1115015633 14:28609445-28609467 CTCCTAGCATTGTAACTCAGAGG + Intergenic
1116215992 14:42017787-42017809 TTCCCGGCACTGTCACTCAGAGG - Intergenic
1118758312 14:68861647-68861669 GTCCTAGCTCTGTCACTCACTGG + Intergenic
1121896955 14:97657555-97657577 GTCCTGGCACTCTCACTGGGTGG - Intergenic
1122118209 14:99538004-99538026 GTCCTAGCTCTGTCAGAGTGAGG - Intronic
1124953748 15:34346351-34346373 GTCTTAGGACTGGCACAGAGAGG + Intronic
1125356098 15:38818612-38818634 ATCCCAGCACCGTCCCTGAGAGG - Intergenic
1125484820 15:40104568-40104590 GTCATGGCACTGTCAGTGAATGG - Intronic
1127334710 15:57972199-57972221 GTCCTGGCTCTGCCACTCAGTGG - Intronic
1127367960 15:58309302-58309324 GTCCCAGCTCTGTCACTCACAGG + Intronic
1128062040 15:64741333-64741355 GTCCTGGTTCTGTCACTGATTGG + Intronic
1128664761 15:69530063-69530085 GACCTGGCACTGCCACTCAGTGG - Intergenic
1129764181 15:78150543-78150565 ATCCTAGCAATGCCACTGATTGG + Intronic
1131180827 15:90238592-90238614 GACCCAGCACTGTCAGGGAGAGG - Intronic
1131185785 15:90272815-90272837 GTCCCAGCACTGCCACTTACTGG - Exonic
1132299118 15:100765664-100765686 CTCCTGCCACGGTCACTGAGAGG + Intergenic
1135161545 16:20101122-20101144 CTCCTAGTACTGTCACTCTGGGG + Intergenic
1140212314 16:72980155-72980177 GTCCTAGCTCTGCCACTGACCGG - Intronic
1140973625 16:80038014-80038036 ATCCTGGCTCTGTCACTTAGTGG - Intergenic
1143500545 17:7336341-7336363 ATCCTGGCTCTGTCACTTAGAGG - Intergenic
1143583084 17:7837586-7837608 ATTCTAGCTCTGTCACTTAGTGG + Intergenic
1144678320 17:17175941-17175963 CTCCTGGCAGTGACACTGAGAGG + Intronic
1152029074 17:77830637-77830659 CTCCCAGCACTGTGACTCAGAGG - Intergenic
1152066052 17:78113071-78113093 GTCCCAGCAGGGTCACTGGGAGG + Exonic
1157335444 18:46734067-46734089 GTCCTGGCACCTTCTCTGAGGGG - Intronic
1157806430 18:50661375-50661397 CTCCCAGCACTGTCTCTTAGTGG + Intronic
1157815660 18:50728017-50728039 GCCCTAGCAGCGTCACTGGGAGG + Intronic
1160395281 18:78566503-78566525 GTCCTAACACTGGGCCTGAGAGG - Intergenic
1160706418 19:532187-532209 GTCCTAGCGCTGTTGCTGGGCGG + Intronic
1161659424 19:5536801-5536823 TTCCCAGCACTGTCACTGCACGG + Intergenic
1162808972 19:13153060-13153082 GTCCTAGCAGTGTCACTGCGTGG + Exonic
1163172489 19:15541991-15542013 GTCCTGGCTCTGTCGCTTAGTGG + Intronic
1163401704 19:17097751-17097773 GACTCAGCACTGTGACTGAGTGG - Intronic
925295972 2:2777684-2777706 TTCCAAGCACTGTCACAGAGGGG - Intergenic
928593969 2:32843112-32843134 GGCCTAGCTCTGTCACAGAAAGG + Intergenic
933771764 2:85749145-85749167 GTGCTAGCACTGTGAATGGGAGG + Intergenic
933809904 2:86026774-86026796 GTCCTGGCCCTGCCACTGTGTGG - Exonic
935610936 2:105024832-105024854 GTCATAACACTGTCCCTGTGAGG - Intergenic
937950799 2:127387095-127387117 GTCTTTGCACTGTCACAGTGTGG - Intronic
938187527 2:129244918-129244940 GTCCTATCTCAGTCAATGAGGGG - Intergenic
939627018 2:144490188-144490210 ATCCCACCACTGTCACTTAGTGG + Intronic
940003645 2:148991754-148991776 GTCCTAGCTCTGTCATTCACGGG - Intronic
945626526 2:212213989-212214011 GTCCTAGCACTGTCCTTGCACGG - Intronic
948715626 2:239859563-239859585 GTACTACCACTGACACAGAGAGG + Intergenic
1172945536 20:38685416-38685438 GTCCTTGCAGAGGCACTGAGTGG + Intergenic
1174347158 20:49938621-49938643 TTCCTAGCACTGTGACGGAGTGG + Intronic
1174823836 20:53750850-53750872 GTCCAGGCACTGTCACTCACCGG - Intergenic
1175457477 20:59126392-59126414 GTCCCAGCAGTGTCACTGTGGGG + Intergenic
1177186592 21:17804212-17804234 TGCCAAGCACTGCCACTGAGTGG + Intronic
1179398976 21:41066608-41066630 GTCCTTGCACTGAGCCTGAGAGG - Intergenic
1180067001 21:45417548-45417570 GTCCTAGAAATGCCACAGAGAGG - Intronic
1181099361 22:20529003-20529025 GACCTAGGGCTGTCACTGGGTGG + Intronic
1181742448 22:24932326-24932348 ATCCCAGCTCTGTCACTGATCGG + Intergenic
1183954831 22:41373199-41373221 GTCCTAGCACTGTGCCTGAATGG + Intronic
1184633301 22:45803593-45803615 GCCCTATAAGTGTCACTGAGAGG - Intronic
950651857 3:14412207-14412229 GTCCTAGCCCTGGCTCTGAAAGG + Intronic
950944051 3:16926305-16926327 TTCCTAGCAGTGTCACTTTGAGG + Intronic
953374486 3:42417221-42417243 ATCCTATCTCTGTCACTGATTGG - Intergenic
955245033 3:57217226-57217248 TTCCTAGCTCTTCCACTGAGAGG - Intronic
956177797 3:66489753-66489775 GTCCCAGCTCTGCCACTGATTGG - Intronic
957161897 3:76621024-76621046 GTCCTTGAAAGGTCACTGAGAGG + Intronic
961975783 3:131023812-131023834 GTCCTAGCACTGACACTTTCTGG + Intronic
964514682 3:157494897-157494919 GTCCTTGAAATGACACTGAGAGG - Intronic
971758811 4:30737097-30737119 GCCCCAGCTCTGTCACTGATTGG + Intronic
973207476 4:47576277-47576299 CTCCTAACACTGTCACAGTGGGG + Intronic
974117165 4:57593152-57593174 GTTATGGCACTGTCAATGAGTGG + Intergenic
983585380 4:169348666-169348688 GACCTAGCTCAGCCACTGAGAGG + Intergenic
984956878 4:185053754-185053776 GGCCTGGTGCTGTCACTGAGGGG + Intergenic
985783255 5:1881699-1881721 GTCCCCGGACTGTCACAGAGGGG - Intronic
986702158 5:10420978-10421000 TTTCTAGCACTCTTACTGAGGGG + Intronic
994881332 5:105500903-105500925 GTCTTCCCACTGTCACTCAGAGG + Intergenic
998999271 5:147902074-147902096 GTCCTGGCACTGGCACTTACTGG - Intronic
999472142 5:151864475-151864497 GTCCTAGCTCTGCCACTCACTGG - Intronic
1000232154 5:159326206-159326228 GTCCTAGGTCTGTCAATGACTGG - Intronic
1001536178 5:172499516-172499538 GTCCAGGCCCTGCCACTGAGTGG - Intergenic
1001879045 5:175227133-175227155 TTCCTAACACTGACGCTGAGAGG + Intergenic
1004417157 6:15435483-15435505 TCCCTAGCACTGGCACTGGGAGG - Intronic
1011740349 6:90353455-90353477 TTCCTAGCACAGTCCCTGTGTGG + Intergenic
1015030316 6:128586785-128586807 GTACAAGCACTGCCACTGGGGGG + Intergenic
1017005819 6:150027504-150027526 GTCCCTGCACAGTCACAGAGGGG - Intergenic
1017554190 6:155545219-155545241 ATCCTAGCACAGGGACTGAGGGG + Intergenic
1017658877 6:156654940-156654962 GTCCTAGTACTGTCAGGGTGTGG - Intergenic
1017758685 6:157551383-157551405 GTCCCAGGCCTGTCACTGATTGG - Intronic
1022749367 7:33207695-33207717 TTTCTAGCACTGTCCCTGAAAGG - Intronic
1023262675 7:38373571-38373593 GTCCAAGCACTGCCACTTAGAGG + Intergenic
1028799805 7:94949637-94949659 GTCATAGCACTGTCATTAAAAGG - Intronic
1032222160 7:130002594-130002616 GTCCTAGCTCTGCCACTCACTGG + Intergenic
1032655635 7:133926233-133926255 ATTCTAGCCCTGTCACTTAGTGG - Intronic
1034966682 7:155395668-155395690 GTCCCAGCACTCACACTGCGGGG + Exonic
1036463427 8:8974274-8974296 GTCCTAGCACTGACCCCTAGGGG - Intergenic
1037877407 8:22554762-22554784 GGCCTGGGACTGTCACCGAGGGG + Intronic
1037905977 8:22716288-22716310 GTCCTGGCACTCTCACTTACTGG + Intronic
1042394288 8:68273865-68273887 GTCACAGCATTGTCAGTGAGTGG - Intergenic
1046544471 8:115631584-115631606 GTCATAGGCCTGTCACTGTGAGG - Intronic
1047762629 8:127965511-127965533 GTCCTGGCACAGTCACAGAGAGG + Intergenic
1047894676 8:129353383-129353405 GACCTGGCTCTGTCACTCAGAGG + Intergenic
1051831469 9:21283427-21283449 TTCCTATCTCTGTCACTGAGAGG - Intergenic
1052050482 9:23842263-23842285 GTCCTTGAACTCTCACTCAGGGG - Intergenic
1053106763 9:35416211-35416233 GTACTAGCACTGGCTCTGATGGG - Intergenic
1059739219 9:117133372-117133394 ATCCTAGCTCTGCCACTGACTGG - Intronic
1060872547 9:127054499-127054521 GGCCTGGCCCTATCACTGAGTGG - Intronic
1061285782 9:129621721-129621743 CTCCCAGCTCTGACACTGAGGGG + Intronic
1061868048 9:133505541-133505563 GTCCTGGCTCTGTCAGTGTGAGG + Intergenic
1190212902 X:48461615-48461637 GTCCTGGGACTGTCACTTGGTGG - Intronic
1193190181 X:78562091-78562113 TTCCTAGGATTTTCACTGAGAGG + Intergenic
1194066754 X:89270880-89270902 TTCCTAGCCCTGTCTCTTAGAGG - Intergenic
1196798273 X:119520013-119520035 GTCCTGGCTCTGTCACTTACTGG - Intergenic
1196862504 X:120041247-120041269 GTCCTAGCACTTCCTGTGAGAGG + Intergenic
1196880598 X:120195097-120195119 GTCCTAGCACTTCCTGTGAGAGG - Intergenic
1198851872 X:140973543-140973565 GTCCCAGAAATGTCAATGAGAGG + Intergenic
1200134712 X:153869300-153869322 GTCTTGTCACTGTGACTGAGCGG - Intronic
1200720927 Y:6605058-6605080 TTCCTAGCCCTGTCTCTTAGAGG - Intergenic