ID: 1074518177

View in Genome Browser
Species Human (GRCh38)
Location 10:114191239-114191261
Sequence GTTTTGCAGCATGTTAACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 522
Summary {0: 1, 1: 0, 2: 8, 3: 128, 4: 385}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074518177_1074518181 25 Left 1074518177 10:114191239-114191261 CCCATGTTAACATGCTGCAAAAC 0: 1
1: 0
2: 8
3: 128
4: 385
Right 1074518181 10:114191287-114191309 ATTGATACACCATCAAGATACGG No data
1074518177_1074518179 -1 Left 1074518177 10:114191239-114191261 CCCATGTTAACATGCTGCAAAAC 0: 1
1: 0
2: 8
3: 128
4: 385
Right 1074518179 10:114191261-114191283 CTATAGTACAATATCACAACTGG No data
1074518177_1074518180 0 Left 1074518177 10:114191239-114191261 CCCATGTTAACATGCTGCAAAAC 0: 1
1: 0
2: 8
3: 128
4: 385
Right 1074518180 10:114191262-114191284 TATAGTACAATATCACAACTGGG 0: 2
1: 44
2: 178
3: 351
4: 685

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074518177 Original CRISPR GTTTTGCAGCATGTTAACAT GGG (reversed) Intronic
900005489 1:45205-45227 TTATTGCAGCATGTTCACAATGG + Intergenic
901742063 1:11348362-11348384 GTTTTGCACACTGTTAACATTGG - Intergenic
903388980 1:22950604-22950626 GTTTTGCAAGATGTTCCCATTGG + Intergenic
903687832 1:25145480-25145502 GTTTTGCAAGATGTTACCATTGG + Intergenic
904306984 1:29596304-29596326 GTTTTACAAGATGTTACCATGGG - Intergenic
904342857 1:29849039-29849061 TTTTTGCAGCATGGTAAAATCGG + Intergenic
905021692 1:34819767-34819789 GTTTTGCAAGATGTTACCACTGG + Intronic
905025382 1:34846094-34846116 CTTTTGCTGCCTGTTTACATGGG - Intronic
905558883 1:38910316-38910338 GTTTTGCAAGATGTCACCATTGG + Intronic
907298948 1:53473644-53473666 GTTTTGCACAATGTCACCATCGG - Intergenic
908178710 1:61582312-61582334 GGTTTGCATCATGTTTTCATTGG + Intergenic
908327544 1:63038193-63038215 GTTTTGCAAAATGTTAAAACTGG + Intergenic
908925245 1:69246554-69246576 CATTTGCAGCAAATTAACATTGG + Intergenic
908955375 1:69619260-69619282 CTTTTTCAGTATGTTGACATTGG + Intronic
909649992 1:77964091-77964113 TTTCTGCAGCATGTTGACATCGG + Exonic
910359257 1:86398013-86398035 GATTTACAGCATCTTGACATTGG - Intergenic
910497918 1:87853468-87853490 TTTATGCAGCATTTAAACATAGG - Intergenic
910731044 1:90397005-90397027 GTTTTTCAGTGTGTTACCATGGG - Intergenic
910848391 1:91626417-91626439 GTTTAGGAGAATGGTAACATAGG - Intergenic
911852462 1:102836645-102836667 GTTATGTAAGATGTTAACATAGG + Intergenic
912592054 1:110833057-110833079 GTTTTACAAAATGTTACCATTGG - Intergenic
913051109 1:115117316-115117338 ATATTACAGCTTGTTAACATAGG + Intergenic
914882175 1:151555866-151555888 GTTTTGCAAGATGTTACCACTGG - Intronic
915152038 1:153841204-153841226 GTTTTGCAAGATGTTACCATTGG - Intronic
915383575 1:155467943-155467965 GTTATGTAAGATGTTAACATTGG - Intronic
917508456 1:175649961-175649983 GTTTTAACACATGTTAACATGGG - Intronic
917801435 1:178574117-178574139 GTTTTGTAAGATGTTACCATTGG - Intergenic
917923938 1:179773450-179773472 GTTTTGCAAGATGTTACCATTGG + Intronic
919420077 1:197359118-197359140 GTTTTGCAACATGGTACTATTGG - Intronic
919717384 1:200792883-200792905 GTTTTGCAAGGTGTTACCATTGG + Intronic
919836310 1:201576026-201576048 GTTTTGCAAGATGTTAACACTGG - Intergenic
920280963 1:204843366-204843388 ATTTTGCAAGATGTTACCATTGG - Intronic
920289491 1:204908580-204908602 GTTTTGCAAAATGTTACTATTGG - Intronic
921120813 1:212135357-212135379 GTTTTGCAAGATGTTACCTTTGG + Intergenic
921399160 1:214701625-214701647 GTTTTGCAAGATGTTATCATTGG - Intergenic
921533560 1:216315638-216315660 GTTTTGCCAGATGTTACCATGGG + Intronic
921958284 1:221006770-221006792 GTTATGAAAGATGTTAACATCGG - Intergenic
922174700 1:223188344-223188366 GTTTTGCAAGATGTTACTATCGG + Intergenic
923451963 1:234126389-234126411 GTTTTGCAAGATGTTACCATTGG - Intronic
923605031 1:235435510-235435532 GTTTTGCAACTTGTTACCAATGG - Intronic
923933873 1:238737677-238737699 GTTTTGCAAGATGTTACCACTGG - Intergenic
924165653 1:241279580-241279602 CTTTTGCAAGATGTTAGCATTGG - Intronic
1063014230 10:2059152-2059174 GTTTTTCAGAAAGTTATCATCGG - Intergenic
1063754574 10:8992871-8992893 CTTTTGCAAGATGTTACCATTGG - Intergenic
1063967520 10:11358334-11358356 GTTTTGCAAGATGTTACCACTGG + Intergenic
1064414538 10:15137040-15137062 GTTTTGCTGTATGTCAACACAGG + Intronic
1064465660 10:15578044-15578066 GTTTTGCAAGCTGTTACCATTGG - Intronic
1064943824 10:20765825-20765847 GTTTTGCAAGATGTTCTCATTGG + Intergenic
1065102770 10:22346937-22346959 GTTTTGAAAAATGTTACCATTGG - Intronic
1065227570 10:23560381-23560403 GTTTTACAAGATGTTATCATTGG - Intergenic
1067241936 10:44504889-44504911 GTTTTGCAAAATGTTACCATTGG + Intergenic
1067765002 10:49078762-49078784 GTTTTGCAAAATGCTATCATTGG + Intronic
1067939127 10:50637928-50637950 GTTTTGCAAGATGTTACCATTGG - Intergenic
1068346336 10:55783852-55783874 GTTTTGCAAGATGTTACCATTGG - Intergenic
1068428957 10:56907698-56907720 GTTTTGCAAGATGTTACCACAGG - Intergenic
1069441957 10:68437135-68437157 GTATGGCACCATGTTTACATTGG + Exonic
1071241911 10:83716386-83716408 GTTTTGCAAAATGTTATTATTGG + Intergenic
1071946459 10:90651091-90651113 GCTTTCCAGCATGATAACACAGG - Intergenic
1072296276 10:94012151-94012173 ATTTTCCAGCATGTGAACCTGGG + Intronic
1073283779 10:102374771-102374793 GTTTTGCATAATGTTACCATTGG + Intronic
1073376182 10:103036988-103037010 GTTTTGCAAGATGTTACCATTGG + Intronic
1073980893 10:109152320-109152342 GTTTTGCAAAATGTTACCATTGG - Intergenic
1074265329 10:111896627-111896649 GTTTTGCAACATGTTACCATTGG + Intergenic
1074439453 10:113462592-113462614 GTTTTGCAAAATGTTAGCATTGG - Intergenic
1074518177 10:114191239-114191261 GTTTTGCAGCATGTTAACATGGG - Intronic
1074922837 10:118034823-118034845 GTTTTGCAGCATGCCAGCATTGG + Intronic
1075188344 10:120283466-120283488 CTTCTGCTGCATGTTAACAGAGG - Intergenic
1076422977 10:130345338-130345360 GTTTTGCAAAATGTGACCATTGG - Intergenic
1077455915 11:2680592-2680614 GTTTTGCAAGATGTTACTATCGG - Intronic
1079474845 11:20819426-20819448 TCTTTGCAGCATGTAAACAACGG - Intronic
1079621251 11:22557547-22557569 GATTTACAGTATGTTAACAGAGG - Intergenic
1079652931 11:22952457-22952479 GTTTTGCAAAGTGTTACCATTGG - Intergenic
1080904175 11:36523834-36523856 GTTTTGCATGATGTTACCATTGG - Intronic
1081443990 11:43111886-43111908 GTTTTGCAAGATGTTATCATTGG + Intergenic
1083066955 11:59934028-59934050 GTTTTGCAAGATGTTACCATTGG - Intergenic
1085578650 11:77630379-77630401 GTTTTGAAGGATGTTAATAAAGG - Intronic
1085586316 11:77710931-77710953 GTTCTGCAGCATGATAAGCTAGG - Intronic
1085756372 11:79205239-79205261 CTTTTGCAAAATGTTACCATTGG - Intronic
1086153033 11:83633854-83633876 GTTTTGCAAAATGTTACTATTGG + Intronic
1087744485 11:101927425-101927447 GTTTTGCAAGATGTTATCATTGG - Intronic
1088602259 11:111491344-111491366 GTTTTGCAAAATGTTACCAAGGG + Intronic
1088926559 11:114308641-114308663 GTTTTGCAGAAAGCTAACAGCGG - Intronic
1089122972 11:116153273-116153295 GTTTTGCAAGATATTATCATTGG + Intergenic
1089621541 11:119725527-119725549 GGTTTGCAGCATGTGTAAATGGG - Intronic
1089678061 11:120103686-120103708 GTTTTGCAAGATGTTAATATTGG + Intergenic
1090115033 11:123960944-123960966 GTTTTGCAAGATGTTACTATGGG + Intergenic
1090161867 11:124503764-124503786 GTTTTGCAAGATGTTACCATTGG + Intergenic
1090324852 11:125876475-125876497 GTTTTGCAAGATGTTACCAGTGG + Intergenic
1092938265 12:13384255-13384277 GTTTTGCAAAATGTTACCATTGG - Intronic
1093641241 12:21528919-21528941 GTATTGCTGCATGTTAGAATAGG + Intronic
1094802819 12:34056985-34057007 ATTTTTCAGCATGTTAAGAGAGG - Intergenic
1095116229 12:38355476-38355498 ATTTTTCAGCATGTTAAGAGAGG - Intergenic
1095430137 12:42125242-42125264 GTTTTGTATCATGTTTACAACGG - Intronic
1096316076 12:50567237-50567259 GTTATGCAAGATGTTAACACTGG - Intronic
1098069734 12:66659234-66659256 GTTATGCAGAAAGTTAACAGAGG - Intronic
1098913898 12:76237816-76237838 GTTTTGCAAAATGTTACCATTGG - Intergenic
1100673536 12:96842311-96842333 GTTTTGCAAGATGTTACCATTGG - Intronic
1101049478 12:100846384-100846406 GTTTTTCAAAATGTTACCATTGG - Intronic
1101893539 12:108736508-108736530 GTTTTGCAAGATGTTACCACTGG - Intergenic
1103548974 12:121722574-121722596 TTTCTGCAGGATGTTAACACAGG - Intronic
1104316335 12:127705900-127705922 ATTTTGCAAAATGTTACCATTGG + Intergenic
1105048029 12:133022551-133022573 GTGTTGCAAAATGTTAGCATTGG + Exonic
1105547929 13:21365357-21365379 GTTTTGGATGAGGTTAACATTGG - Intergenic
1105562871 13:21511571-21511593 GTTTTGCAAGATGCTACCATTGG - Intronic
1106232954 13:27835988-27836010 GTTTTGCAAAATGTTACCAATGG - Intergenic
1107134960 13:36933670-36933692 GTTTTGCAGGATGCTACCACTGG - Intergenic
1107203125 13:37746684-37746706 ATTTTACAGCATCTTAAAATAGG + Intronic
1107958105 13:45536775-45536797 GTTTTGCAAGATGCTACCATTGG - Intronic
1108166012 13:47693801-47693823 ATTTTGCAAGATGTTACCATTGG - Intergenic
1110644778 13:77869611-77869633 GTTTTGCAAGATGTTACCATTGG - Intergenic
1111286533 13:86100515-86100537 ATTTTGCAGCAGGCTAACAGAGG - Intergenic
1111574961 13:90142003-90142025 TTTTTGCAAGATGTTACCATTGG + Intergenic
1111974531 13:94951800-94951822 GTTTTGCAGGATGTGAGCAGAGG + Intergenic
1112230081 13:97581004-97581026 GTTTTGCACAATGTTGCCATTGG + Intergenic
1112578027 13:100654250-100654272 GTTTTTGAGAATGTTAACCTGGG - Intronic
1112982311 13:105400198-105400220 GTTGTACAGCATGTTAGGATGGG - Intergenic
1113476923 13:110590458-110590480 GTTTTGCAAGATGCTATCATTGG + Intergenic
1115076419 14:29397704-29397726 GTTTTGCAAAATGTTATCATTGG - Intergenic
1115298848 14:31861102-31861124 GTTTTGCAAGATGTTACCACTGG + Exonic
1115554851 14:34536934-34536956 GTTTTGTAGTATGTTAACACTGG + Intronic
1115696571 14:35905617-35905639 GTTTTGCAAGATGTTACCATTGG - Intronic
1115731980 14:36280087-36280109 GATTTGCAGCATGTCAAAACTGG - Intergenic
1116314287 14:43367597-43367619 GTTTTGCAACATATTACCAGTGG + Intergenic
1117122794 14:52586479-52586501 GTTTTGCAGAATTTTAACAACGG + Intronic
1117357766 14:54942379-54942401 GTTTTGCAAAATGTTACCACTGG - Intronic
1119105807 14:71922519-71922541 GTTATGTAAGATGTTAACATAGG - Intergenic
1119170873 14:72535467-72535489 GTTTTGCAAGATGTTGCCATTGG - Intronic
1120714596 14:87827114-87827136 GTTTTGTAACATGTTACCGTTGG - Intergenic
1121710592 14:96036074-96036096 ATTTTGCAAGATGTTATCATTGG + Intergenic
1123049465 14:105533769-105533791 CTTTTGCAGAATGTGAACCTGGG - Intergenic
1123126524 14:105950674-105950696 GTTTTGTAACATGTCTACATAGG + Intergenic
1123407038 15:20026777-20026799 GTTTTGTAACATGTCTACATAGG + Intergenic
1123516369 15:21033433-21033455 GTTTTGTAACATGTCTACATAGG + Intergenic
1124074518 15:26432150-26432172 ATTTTGCAAAATGTTATCATTGG + Intergenic
1124174656 15:27412219-27412241 CTTTTGCAGGATGTCACCATTGG - Intronic
1124553206 15:30701498-30701520 GTTTTGCACAATGCTACCATTGG - Intronic
1124592639 15:31066916-31066938 GTTTTGCAAGATGTTACCATTGG + Intronic
1124678035 15:31704173-31704195 GTTTTGCACAATGCTACCATTGG + Intronic
1124918680 15:34002076-34002098 GTTTTGCAAAATGTTATCATTGG - Intronic
1124990011 15:34663503-34663525 GTTTTGTAAAATGTTATCATTGG + Intergenic
1125377413 15:39045211-39045233 GGTTTGAATCTTGTTAACATTGG - Intergenic
1125878660 15:43172394-43172416 GTTTTACAGCATGTGAATTTCGG + Intronic
1125987560 15:44069777-44069799 GTTTTGCAAGATGTTACCATAGG + Intronic
1126261744 15:46701275-46701297 GTTTTGCAAGATGTTATCATTGG - Intergenic
1126471768 15:49020168-49020190 GTTTTGCAAGATGTTACCACAGG + Intronic
1126946910 15:53831611-53831633 GTTTTGCAAAATGTTACCAATGG - Intergenic
1126991782 15:54386436-54386458 TGTTTGGAGCATGTTAGCATGGG + Intronic
1128174659 15:65544479-65544501 GTTTTGTAGAATGCTACCATTGG + Intronic
1128257613 15:66210188-66210210 GTTTTGCAAGATGTGACCATTGG + Intronic
1129039927 15:72677035-72677057 GTTTTGGAAGATGTTACCATGGG + Intronic
1129430629 15:75498985-75499007 GTTTTGGAAGATGTTATCATGGG + Intronic
1130645848 15:85726195-85726217 TTTTAGCAGCATTTTAAAATGGG - Intronic
1130943772 15:88534969-88534991 CTTTTGTAGCATCTCAACATTGG - Intronic
1131370829 15:91880278-91880300 GTTTTGCAATATGTTACTATTGG - Intronic
1131728589 15:95254456-95254478 GTTTTGCAAGATGTTAGCATTGG - Intergenic
1131766354 15:95679982-95680004 GTTTTGCCAAATGCTAACATCGG - Intergenic
1131896382 15:97035103-97035125 GTTTTGCAAGATGTTACCACTGG + Intergenic
1132296624 15:100739797-100739819 GTTTTGAAAGATGTTACCATTGG - Intergenic
1132448027 15:101945719-101945741 TTATTGCAGCATGTTCACAATGG - Intergenic
1133461062 16:5986443-5986465 GTTTTGCAAAATGTTGACACTGG - Intergenic
1134030335 16:10987256-10987278 GTTTTGCAAGATGTTACCACTGG - Intronic
1134285584 16:12859264-12859286 ATTTTGCAAAATGTTACCATTGG - Intergenic
1134684555 16:16149639-16149661 GTTTTGCAAGATGTTACCATTGG + Exonic
1134909485 16:18011535-18011557 GTTTTGCAAAATGTTACCACTGG - Intergenic
1138259630 16:55606222-55606244 GTTTTGCAAGATGTTACCACTGG + Intergenic
1138639469 16:58372016-58372038 GTTTTGCAAGATGTTACCATTGG - Intronic
1138653851 16:58478615-58478637 GTTCTGTAGCATGATAACATTGG + Intronic
1138862634 16:60776365-60776387 TTTTTGCAAGATGTTACCATCGG - Intergenic
1140069699 16:71638700-71638722 GTTATGCAGTATATTATCATTGG - Intronic
1140160139 16:72481755-72481777 GTTTTGCAAAATGTTATCATTGG + Intergenic
1140426549 16:74866115-74866137 GTCTTGCAAGATGTTACCATTGG - Intergenic
1140937689 16:79690104-79690126 ATTTTGCAAGATGTTACCATTGG + Intergenic
1142678067 17:1527771-1527793 GTTTTGCAAGATGTTACCATTGG + Intronic
1143738315 17:8930998-8931020 GTTTTGCAAGATGTTACCATTGG + Intronic
1145088010 17:19960127-19960149 GCTTTGCAAGATGTTACCATGGG - Intronic
1147523392 17:41196554-41196576 GTTTTGCAAGAAGTTATCATTGG - Intronic
1147630751 17:41929759-41929781 GTTTTTAAGGATGTTACCATTGG - Intronic
1148573531 17:48690458-48690480 GTTTTGCAACATGTTACCATTGG - Intergenic
1148833690 17:50453651-50453673 GTTTTGCAAGATGTTAACATTGG + Intronic
1148940514 17:51206055-51206077 TTTTTCCAGCATGTTCACATCGG - Intronic
1148947927 17:51281701-51281723 GTTATGCAAAATGTTAACATTGG + Intronic
1149128226 17:53261345-53261367 GGTTTGCAGAAAGTTAAAATAGG + Intergenic
1149155224 17:53621429-53621451 CTTTTGCAGGATGCTAAAATGGG + Intergenic
1149201505 17:54190946-54190968 GTTTTGCAAGATGTTACTATTGG - Intergenic
1149466437 17:56883623-56883645 GCTTTTTAGCAAGTTAACATAGG - Intergenic
1149797946 17:59538715-59538737 GTTATGTAACATGTTAACACTGG - Intergenic
1150651829 17:67015494-67015516 GTTTTGCACGATGTTGTCATGGG + Intronic
1152620126 17:81359199-81359221 GTTCTGCAAGATGTTACCATTGG - Intergenic
1155031435 18:21988333-21988355 GTTTTGCAGGATGTTATCAGTGG + Intergenic
1155705571 18:28806497-28806519 GTTATGCAAGATGTTACCATTGG - Intergenic
1156173738 18:34517357-34517379 GTTTTGCAAGCTGTTACCATTGG - Intronic
1157479374 18:48043704-48043726 GTTTTGCAAGATGTTACCACTGG + Intronic
1157672945 18:49545778-49545800 GTTTTTTAACATGATAACATTGG - Intergenic
1158270756 18:55713166-55713188 ATTTTGCAAGATGTTACCATTGG - Intergenic
1158344565 18:56503120-56503142 GTTTCGCAAGATGTTACCATTGG + Intergenic
1159046774 18:63376203-63376225 ATTTTGCAGGATGTTACCACTGG + Intergenic
1160128503 18:76203304-76203326 GTTTTGCAAGATTTTACCATTGG + Intergenic
1160198318 18:76775713-76775735 GTTTTGCAAAATGTTACCATTGG + Intergenic
1160637244 19:86816-86838 TTATTGCAGCATGTTCACAATGG + Intergenic
1162005564 19:7776432-7776454 GTAATGCAAGATGTTAACATCGG + Intergenic
1162972247 19:14187740-14187762 ATTTTCCAGCATGTTACCTTGGG + Intronic
1163176835 19:15570061-15570083 GCTTTGCAGCAAGTTAGCAGGGG - Intergenic
1163376417 19:16935188-16935210 ATTTTGCAAGATGTTACCATGGG - Intronic
1164898945 19:31901729-31901751 TTTTTGCTGGATGTCAACATAGG - Intergenic
1165635621 19:37337365-37337387 GTTTTGAAGGATGTTAAGAAGGG + Intronic
1166284441 19:41815476-41815498 GTTATGCAAAATGTGAACATTGG - Intergenic
1167087738 19:47321769-47321791 GTTTTGCAAGATGTTGCCATTGG - Exonic
1168532974 19:57144536-57144558 GTTTTGATACATGTTTACATTGG - Intronic
926287022 2:11496751-11496773 GTTTTGCAAAATGTTATCATTGG - Intergenic
926417702 2:12666131-12666153 GTTTTGTAACATGTTACCACTGG - Intergenic
926788531 2:16545445-16545467 GTTTTGTAGCATGGGAAAATGGG + Intergenic
927222804 2:20729744-20729766 GTTTTGCAAGATATTACCATGGG - Intronic
927690647 2:25205671-25205693 GTTCTGCAAGATGTTACCATTGG - Intergenic
929423984 2:41825409-41825431 GTTTTGCAAGATGTTACTATTGG + Intergenic
931424680 2:62159877-62159899 GTTTTGAAGGATGTTACCATGGG + Intergenic
931795499 2:65705186-65705208 GTTCAGCAAGATGTTAACATTGG + Intergenic
931795637 2:65707228-65707250 GTTCAGCAAGATGTTAACATTGG + Intergenic
932193381 2:69760627-69760649 GTTTTCTAGCATTTTGACATAGG + Intronic
932292975 2:70598069-70598091 GTTTGGCAACATGTTACCATTGG - Intergenic
933009122 2:77035326-77035348 GTTTTGCAAGATATTATCATCGG - Intronic
933679240 2:85084472-85084494 GTTTTGCAAGATGTTACCATTGG + Intergenic
933788523 2:85864199-85864221 GTTTTGCAGGATGCTATCATGGG + Intronic
933865875 2:86516988-86517010 GTTTTGCAAGATGTTACTATCGG + Intronic
934051279 2:88213208-88213230 GTTATGCAAGATGTTAACATTGG - Intergenic
934863585 2:97786144-97786166 GTTTTGCAATGTGTTACCATTGG + Intronic
934908726 2:98230394-98230416 ATTTTGCAAGATGTTACCATTGG - Intronic
937110236 2:119361097-119361119 GTTTTGCAAGATGTTACCACTGG + Intronic
937130360 2:119506981-119507003 GTTTTGCAAGATGTTACCATTGG + Intronic
937618299 2:123953761-123953783 GTTTTGCAAGATGTTACCATTGG + Intergenic
937962289 2:127469409-127469431 TTTCTGCTGCATTTTAACATAGG - Intronic
938143718 2:128817025-128817047 GTTTTGCAAGATGTTACCATTGG + Intergenic
938980371 2:136520663-136520685 GTTTTGCAAAATGTTACCATTGG + Intergenic
939026627 2:137021619-137021641 GTTTTGCAAGATGTAAACATTGG - Intronic
939036786 2:137141607-137141629 GTTGTGCAAGATGTTACCATGGG + Intronic
939457701 2:142459637-142459659 GTTTTGCAAGATGTCACCATTGG + Intergenic
939682704 2:145158377-145158399 GTTTTGCACAATGTCAACATAGG - Intergenic
939697311 2:145342915-145342937 GTTTTGCAAGATATTACCATTGG + Intergenic
940119107 2:150242985-150243007 GTTTTGCAAAATGTTACCACTGG - Intergenic
940861862 2:158779008-158779030 GTTTTGCAAGATGTTACCATTGG + Intergenic
941036400 2:160573734-160573756 CTTTTGCAAGATGTTACCATTGG + Intergenic
941211183 2:162641759-162641781 GTTTTGCAAAATGTTATCATTGG + Intronic
941211185 2:162641791-162641813 GTTTTGCAAAATGTTATCATTGG + Intronic
941698289 2:168576663-168576685 GTATGGCATCATGTTAACAGTGG - Intronic
941828020 2:169921480-169921502 GTTATGGAGAATGTGAACATAGG + Intronic
942153623 2:173104616-173104638 GTGATGCAGCATGTTAACATGGG + Intronic
942175138 2:173326054-173326076 GTTTTGCAAAATGTTACCACTGG - Intergenic
942255201 2:174090204-174090226 CTTTTGCAGCATATAAAAATTGG + Intronic
942284661 2:174403820-174403842 GTTTGGCAAGATGTTACCATTGG + Intronic
943014585 2:182495472-182495494 GTGTTACAGCATGTTAAAATGGG - Intronic
943068422 2:183113479-183113501 GTTTTGCAAGATGTAATCATTGG + Intergenic
943175568 2:184468664-184468686 GTTACGCAAGATGTTAACATTGG - Intergenic
943647522 2:190423154-190423176 GTTTTGCAAGATGTTATCACTGG - Intronic
944051127 2:195471145-195471167 GTTTTGTAAGATGTTAACAGAGG - Intergenic
944843713 2:203647542-203647564 GTTTTTGAACATGTCAACATTGG - Intergenic
945701929 2:213181513-213181535 GTTTTACAAAATGTTAACATTGG - Intergenic
945779302 2:214148354-214148376 GTTTTGCAGCATAGTAGCAGTGG - Intronic
946038661 2:216765361-216765383 GTTTTGCAGGATGTTGCTATTGG + Intergenic
946909432 2:224444907-224444929 GTCTTGCATGATGTTACCATTGG + Intergenic
947295079 2:228621817-228621839 GTTTTGCAAGATGTTACCACTGG + Intergenic
947366511 2:229401723-229401745 GTTTTACAATATGTTATCATTGG + Intronic
947550936 2:231046185-231046207 GTTTTGCAAAATGTTACCATTGG - Intronic
948224351 2:236297591-236297613 ATTTTGCAAGATGTTACCATTGG + Intergenic
948683373 2:239653028-239653050 GTTTTGTAGGATGTTACCATGGG + Intergenic
1168907150 20:1415606-1415628 GTTTTGCAAAACGTTATCATTGG + Intergenic
1169035662 20:2449751-2449773 GTTTTGCAAGATGTTACCATTGG + Intergenic
1169246465 20:4028947-4028969 GTTATGCAAGATGTTACCATTGG - Intergenic
1169573626 20:6933266-6933288 GTTATGCAAAATGTTAATATTGG - Intergenic
1169643430 20:7780843-7780865 GTTTTGCAAGATGTTAATGTTGG - Intergenic
1170463424 20:16600248-16600270 GTTATGCAAGATTTTAACATTGG + Intergenic
1171198218 20:23218872-23218894 TTTTTGCAGCATTGTAAAATGGG + Intergenic
1172066713 20:32226333-32226355 GTTTTGCAAAATGTTACCATTGG - Intronic
1172360158 20:34307036-34307058 GTTTTGCAAGATGTCACCATTGG + Intronic
1172616278 20:36287299-36287321 GTTTTGCAAGATGTTACCATTGG - Intergenic
1173262809 20:41451694-41451716 GTTTTTCAGAATGTTACCAGTGG - Intronic
1173378911 20:42518995-42519017 GTTTTGGAAGATGTTAAAATGGG - Intronic
1173721567 20:45262832-45262854 CATGTGCAGCTTGTTAACATGGG + Intergenic
1173884033 20:46441065-46441087 GTTTTGCAAGATGTTACCACTGG - Intergenic
1174485755 20:50860178-50860200 GTTTTGAAGCATGTTACCACTGG - Intronic
1175551089 20:59818201-59818223 GTTTTCCAGCATGTGGGCATGGG + Intronic
1175656749 20:60777434-60777456 GTTTCGCAAGATGTTACCATTGG - Intergenic
1175970060 20:62681281-62681303 GTTTTGTAGAATGTTACCATTGG - Intronic
1176877082 21:14142046-14142068 GTTTTGCATCATTGTAACAGGGG - Intronic
1177447158 21:21212643-21212665 GTTTTGCAAAATGTTATCAGTGG + Intronic
1177677945 21:24326976-24326998 GTTTTGCAGAATGTTTATGTTGG + Intergenic
1179363424 21:40733763-40733785 GTCTTGCTGCAACTTAACATGGG - Intronic
1180906764 22:19418819-19418841 GTTTTGCAAAATGTTAACATTGG + Intronic
1181309303 22:21935460-21935482 GTTTTGCAAAATGTTACCATTGG + Intronic
1182629086 22:31670801-31670823 GTTTTGCAAGATGTTACCATTGG + Intergenic
1183843544 22:40521131-40521153 GTTTTGCAAGATGTTATCATTGG - Intronic
1185124564 22:49000775-49000797 GCTTTGCAAAATGTTACCATAGG + Intergenic
950450797 3:13064056-13064078 GTTTTGTAAGATGTTACCATTGG - Intronic
950472621 3:13195903-13195925 GTTTTGTAAAATGTTACCATTGG + Intergenic
950985681 3:17362874-17362896 GTTTTGCAGGATGTTACCATTGG - Intronic
952724100 3:36563922-36563944 GTTTTGCAAGATGTTACCACTGG - Intergenic
953345806 3:42174436-42174458 ATCTTGCAGAATGTTACCATTGG + Intronic
953390855 3:42532916-42532938 GTTTTGGAGCAGGTCACCATGGG + Intronic
953733835 3:45474158-45474180 GATTTGCAGCTTGTTAAGGTAGG - Intronic
954237566 3:49268536-49268558 GTTATGTAAGATGTTAACATTGG - Intergenic
954270460 3:49504000-49504022 GTTTTGCAAGATGTTACCATGGG - Intronic
955372164 3:58361357-58361379 GGTTTGCAAGATGTTACCATTGG - Intronic
955646753 3:61147495-61147517 ATATTGCAGCATATTAAAATTGG - Intronic
955957129 3:64302458-64302480 GTTTTGAATCATGTTAAAAAAGG - Intronic
956205858 3:66754055-66754077 GTTATGCAGCCTCATAACATTGG + Intergenic
956680719 3:71777109-71777131 GTTTTGCAAGATGTCACCATTGG + Intronic
957154433 3:76529806-76529828 CCCTTGCAGCATTTTAACATAGG + Intronic
957360055 3:79143719-79143741 GTTTTGCAAGATGTTACCACTGG - Intronic
957834472 3:85569004-85569026 GTTTTGCAAGATGTTACCATGGG - Intronic
958606792 3:96368280-96368302 GTTTTGCAAAATGTTATCACTGG - Intergenic
958855781 3:99383479-99383501 GTTTTTCAAAATGTTACCATTGG + Intergenic
958858484 3:99416578-99416600 GTTTTGTGAGATGTTAACATTGG + Intergenic
958958768 3:100489309-100489331 ATTCTGCAGAATGTTACCATTGG - Intergenic
959607006 3:108251873-108251895 GTTTTGCAAGATGTTACCATTGG - Intergenic
959643412 3:108667613-108667635 GTTTTGCAAGATGTTACCATGGG + Intronic
959923599 3:111896968-111896990 GTTTGGCAAGATGTTACCATTGG - Intronic
960013500 3:112859145-112859167 GTTTTGCAAAATGTTAGCACTGG + Intergenic
960251870 3:115464312-115464334 GTTTTGAAATATGTTAACATTGG + Intergenic
960605936 3:119505175-119505197 GTTTTGCAGTATGTATATATTGG - Intronic
960821720 3:121740285-121740307 GTTTTGCAAAATGTTACCACTGG + Intronic
960984218 3:123262930-123262952 GTTTTGCAAGATGGTAACATTGG - Intronic
961095092 3:124147616-124147638 GTTGTGCAAGATGTTAACAGTGG - Intronic
962044761 3:131744462-131744484 GCTTTGTAGGATGTTACCATCGG - Intronic
962121877 3:132569931-132569953 GTTTTGCAAGATGTTACCATTGG + Intronic
963316928 3:143769381-143769403 GTTTTGGCTAATGTTAACATGGG - Intronic
963368921 3:144372727-144372749 GTTTTTCAGCTTTTTAACGTGGG + Intergenic
963693933 3:148540880-148540902 GTTTTGCAAGATGTTACCAGTGG - Intergenic
964200970 3:154119291-154119313 CTTTTACAGCTTCTTAACATAGG + Intergenic
964718093 3:159743793-159743815 GTTTTGCAAGATGTTACCATTGG + Intronic
965440779 3:168711219-168711241 CTTATGCAGAATCTTAACATAGG + Intergenic
966267600 3:178064829-178064851 GTTTTGCAAAACGTTACCATTGG - Intergenic
966957770 3:184901609-184901631 TTTTTGCAAGATGTTATCATTGG - Intronic
967226573 3:187297825-187297847 GTTTTTCAGGATTTTAACATTGG + Intergenic
967300781 3:188009998-188010020 GATTTGCAAGATGTTAACATAGG - Intergenic
967393744 3:188983168-188983190 GTTTTGCAAGATGCTACCATGGG - Intronic
967401745 3:189070519-189070541 GTTTTGCAAAATGTTACCACTGG + Intronic
967703925 3:192627751-192627773 GTTTTGCAAAATATTACCATTGG - Intronic
970621109 4:17819907-17819929 GTTCTTCATGATGTTAACATGGG - Intronic
970750841 4:19358599-19358621 GTTTTGCAAGATGTTACCATTGG + Intergenic
973874302 4:55200627-55200649 GTTTTGCAAGATATTACCATTGG + Intergenic
975044749 4:69787621-69787643 GTTTTGCAACATGTTACCACTGG - Intronic
975225701 4:71869361-71869383 ATTTTGCAAAATGTTACCATTGG - Intergenic
975838066 4:78444985-78445007 CATTTGCAGCATGTTTTCATTGG - Intronic
975945448 4:79700530-79700552 GTGTTGCAAGATGTTATCATTGG - Intergenic
976449813 4:85175382-85175404 GTTTTGCAAGATGTTACCATTGG - Intergenic
977155294 4:93565341-93565363 GTTTTGCAAAATGTCACCATTGG + Intronic
977421055 4:96800168-96800190 GTTTTGAAAGATGTTATCATTGG + Intergenic
977916927 4:102604395-102604417 GTTATGCAGGATGTTACCATTGG - Intronic
978165124 4:105597751-105597773 GTTTTGCAGGATGTTAGCCTTGG + Intronic
978733019 4:112052752-112052774 GTTTTCCAAAATGTTACCATTGG - Intergenic
978794346 4:112694156-112694178 GCTTTGTAAAATGTTAACATGGG + Intergenic
980247136 4:130261445-130261467 GTTTTGTAAGATGTTATCATTGG - Intergenic
980562540 4:134496725-134496747 GTTTTTCAACATCTTATCATTGG - Intergenic
982186689 4:152809071-152809093 GTGTTGTAGCATGTAAACACAGG + Intronic
982204414 4:152986655-152986677 GTTTTGCAATATGTTGCCATTGG + Intergenic
983584964 4:169344613-169344635 GTTTTGCAAGATGTTACCATTGG - Intergenic
984860933 4:184237323-184237345 GTTATGTACGATGTTAACATTGG + Intergenic
985200374 4:187478553-187478575 GTTCTGCTGCATGTGGACATGGG + Intergenic
987192743 5:15495943-15495965 GTTTTGCAAGATGTTACCACTGG - Intergenic
988504079 5:31806900-31806922 TTTTTGCAGAATGTAAACTTTGG + Intronic
988644541 5:33079903-33079925 TTTTATCAGCATTTTAACATTGG + Intergenic
990147147 5:52775211-52775233 GTTTGGTATCATGTAAACATGGG - Intergenic
991452595 5:66768760-66768782 GTTTTTCAAGATGTTACCATTGG + Intronic
992927262 5:81601522-81601544 GTTTTGCAATATTTTACCATTGG + Intronic
992981792 5:82182838-82182860 GTCTTGCAAGATGTTACCATTGG + Intronic
994077413 5:95669140-95669162 GTTCTACAGAATGTTAACACTGG - Intronic
995419916 5:111952783-111952805 GTTATGCAAGATGTTACCATTGG + Intronic
997028646 5:130096519-130096541 GTTATGTAACATGTTAACAGAGG + Intronic
997275859 5:132588541-132588563 GTTTTGCAAAATGTTATCATTGG + Intronic
997669665 5:135660229-135660251 GTTTTGCAAGATGTTATCATGGG - Intergenic
997677782 5:135726329-135726351 CTTTTGCAAGATGTTACCATTGG - Intergenic
999172775 5:149609415-149609437 GTTTACCAGCATGTCACCATGGG - Intronic
999426858 5:151495423-151495445 GTTATGCAAGATGTTAACACTGG - Intergenic
999674444 5:153984782-153984804 GTTTTGCAAGCTGTTATCATTGG - Intergenic
1001355209 5:171014904-171014926 GTTTTGGAAGATGTTAACAATGG + Intronic
1003252624 6:4444191-4444213 GTTTTGCAAGACGTTATCATTGG - Intergenic
1003907003 6:10710746-10710768 GTTTTGCAAGATGTTATCATTGG - Intergenic
1004939688 6:20542678-20542700 GTTTTGCAAGATGTTACCAACGG - Intronic
1005762388 6:28979422-28979444 GTTTTGCAAGATGTTACCATTGG + Intergenic
1006233736 6:32608906-32608928 GTATTACAGCAAGTTTACATTGG - Intergenic
1006547086 6:34789248-34789270 GTTTTGCAAGATGTTATTATTGG + Intergenic
1007145721 6:39628134-39628156 GTTTTGCAAGATGTTACAATTGG - Intronic
1007463625 6:42036052-42036074 GTTGCGCAGCAAGCTAACATTGG - Intronic
1007963040 6:45978500-45978522 GTTCTGATGCATGCTAACATTGG - Intronic
1008026609 6:46643995-46644017 GTTTTGCAAGATGTTAATACTGG - Intronic
1008755238 6:54787333-54787355 TTTCTGCAGTATGTTACCATTGG + Intergenic
1009661419 6:66616718-66616740 GTTTTGTAACATGTTTACTTGGG - Intergenic
1010447526 6:75964746-75964768 GTTTTGCAGGATGTTATTAGGGG - Intronic
1011290033 6:85767168-85767190 GTTTTACAGGAAGTTACCATAGG - Intergenic
1012025262 6:93981750-93981772 GTTTAGCTCCATGATAACATTGG + Intergenic
1012885346 6:104840093-104840115 GTTTTGCAAAATGTTACCACTGG + Intronic
1012945556 6:105461834-105461856 GTTTTGCAAGATGTTATCACTGG - Intergenic
1013121448 6:107144870-107144892 GTTTTGCAAGATGTTACCATTGG + Intergenic
1013743865 6:113321315-113321337 GTCTTGCAGTATGTTTACTTTGG + Intergenic
1014062627 6:117090708-117090730 GTTTTGCAAGATGTTACCATTGG + Intergenic
1015155692 6:130093198-130093220 GCTTTGCAAAACGTTAACATTGG + Intronic
1015398942 6:132767120-132767142 GTTCTGCAAGATGTTATCATTGG + Intergenic
1015468484 6:133575430-133575452 GTTTTGCAATGTGTTACCATTGG + Intergenic
1015539924 6:134303447-134303469 GTTTCCGAGCATGGTAACATCGG - Intronic
1016259741 6:142153918-142153940 GTTTTGCAAGATATTATCATTGG - Intronic
1016280078 6:142406848-142406870 GTTTTGCTGCATTTTTATATTGG - Intronic
1016561333 6:145398114-145398136 ATTTTGCACCATGTTGAGATAGG + Intergenic
1016903666 6:149128180-149128202 GTTTTATAGAATGTTAATATTGG + Intergenic
1017932597 6:158971666-158971688 GGTTAGCAACATGTTAAGATAGG + Intergenic
1019855175 7:3598482-3598504 CTTTTGTAACATGTTACCATTGG - Intronic
1019931318 7:4225202-4225224 GTTTTGCAGGATGTTACCACTGG + Intronic
1020514451 7:9098617-9098639 GTTTTGTAAGATGTTATCATTGG - Intergenic
1020805784 7:12789053-12789075 GTTATGTAACATGTTAACACTGG + Intergenic
1021090414 7:16476311-16476333 GTTTTGCAGTATGTTAGGGTTGG - Intronic
1021591100 7:22263258-22263280 GTTTTGCAAAATGTTATCATTGG + Intronic
1022763929 7:33389038-33389060 GTTTTGCAAAATGTTACCATTGG - Intronic
1022770359 7:33465142-33465164 GTTTTGCAGCATGTAGAGATGGG + Intronic
1022865408 7:34413549-34413571 GTTTTGCAATATGTTGCCATTGG - Intergenic
1022992193 7:35719579-35719601 GTTTTGCAAGATGTTACCATTGG + Intergenic
1023044752 7:36201355-36201377 GTTTTGTAGGAGGTTAACTTTGG + Intronic
1023490818 7:40739106-40739128 GTTTTGCAAGAAGTTACCATTGG - Intronic
1023937858 7:44752047-44752069 GTTTTCCAAGATGTTACCATTGG - Intronic
1024895832 7:54260760-54260782 GTTTTGCAAGATGTTACCATTGG - Intergenic
1025934884 7:66027560-66027582 GTTATGTAAGATGTTAACATCGG + Intergenic
1026555297 7:71403282-71403304 GTTTTGCAAGATGTTACCACTGG - Intronic
1026763209 7:73142264-73142286 GTTTTGCAAGCTGTTACCATTGG + Intergenic
1027039674 7:74952048-74952070 GTTTTGCAAGCTGTTACCATTGG + Intergenic
1027083968 7:75250338-75250360 GTTTTGCAAGCTGTTACCATTGG - Intergenic
1027415259 7:77967471-77967493 GTTTTGGAACATGTAAAAATGGG - Intergenic
1028669956 7:93390477-93390499 GTTTTGCAAGATGTTGCCATTGG + Intergenic
1029217140 7:98958664-98958686 AGTTGACAGCATGTTAACATTGG + Intronic
1030001565 7:105069696-105069718 GTTATGCAAGATGTTAACACTGG - Intronic
1030465926 7:109903760-109903782 GTTTTGTATCAGGTTAACACTGG + Intergenic
1030927008 7:115470324-115470346 GTTAGGCAAGATGTTAACATCGG + Intergenic
1031344216 7:120645266-120645288 GTCTTGTGGCATGTTAATATAGG + Intronic
1031658645 7:124392365-124392387 GTGTTTCAGCACGTTAACTTTGG - Intergenic
1031828497 7:126596833-126596855 ATTTTGCAAAATGTTATCATTGG + Intronic
1031910518 7:127512357-127512379 GTTTTGCAGGATGCTACCATTGG + Intergenic
1031984148 7:128151807-128151829 GTTTTGCAAGATGTGACCATTGG - Intergenic
1032242069 7:130170328-130170350 CTTCTGCAGAATCTTAACATAGG + Intronic
1032973332 7:137191522-137191544 GATTTGCAACATGTTACCATTGG - Intergenic
1034837306 7:154364464-154364486 GTTTTACAGCTTGTTAACTGGGG - Intronic
1038101114 8:24376939-24376961 GTTTTGCAAGATGTTACCATTGG + Intergenic
1038355101 8:26821615-26821637 GTTTTGCAAGATGTTGCCATTGG - Intronic
1038533683 8:28338761-28338783 GTGTCACAGCACGTTAACATAGG - Intronic
1038974958 8:32685016-32685038 GTTTTGCAGAATGTTACCATTGG - Intronic
1039660979 8:39464901-39464923 GATTTGCAACATTTTAACATTGG + Intergenic
1040426324 8:47290455-47290477 GTTTTGCAAGATATTACCATTGG + Intronic
1040534090 8:48290858-48290880 GATTTGCAAGATGTTACCATGGG - Intergenic
1040770955 8:50974717-50974739 GTTATGCAAGATGTTAACATTGG - Intergenic
1040996307 8:53406262-53406284 GTCTTGCAGCAAGTTAACCACGG - Intergenic
1041184881 8:55288736-55288758 GTTTTGCAAGATGTTACCTTTGG - Intronic
1041308613 8:56490458-56490480 GATTTGCAAAATGTTACCATTGG + Intergenic
1041643499 8:60228087-60228109 GTTTTGCAGTTAGTTAACATTGG - Intronic
1041680968 8:60590779-60590801 GTTTTACAACTTGTTAACTTTGG - Intronic
1041916393 8:63143848-63143870 GTTTTGCAAAACGTTAACATTGG - Intergenic
1042202503 8:66292806-66292828 GTTTTGCATGATGTTACTATTGG - Intergenic
1042292193 8:67180674-67180696 GTTTTGCAAAATGTTACCATTGG + Intronic
1043985096 8:86685094-86685116 GTTTTGCAAGATGTTACAATTGG + Intronic
1044213095 8:89573725-89573747 GTTTTGCAAGATATTATCATTGG - Intergenic
1044501573 8:92964905-92964927 CTTGTGCTGCTTGTTAACATTGG - Intronic
1044664140 8:94618978-94619000 GTTTTGCAAAATGTTACCACTGG + Intergenic
1045139935 8:99268770-99268792 GTTTTGAAGCATGAGAACATGGG + Intronic
1045198114 8:99950551-99950573 TTTTTGCTGCATCATAACATTGG - Intergenic
1045207716 8:100059798-100059820 GTTATGCAAGATGTTACCATTGG + Intronic
1045257106 8:100535416-100535438 GTTTGGCAAGATGTTACCATTGG - Intronic
1045399588 8:101799894-101799916 GTTTTGCAAGATGTTACCTTTGG + Intronic
1046789047 8:118300904-118300926 TTTATGCATCATGTTAAAATAGG - Intronic
1047065453 8:121277105-121277127 GTTTTATAGAATGTTACCATTGG - Intergenic
1047446263 8:124922807-124922829 GTTTGGCAACATGTTACCACTGG + Intergenic
1050275175 9:3989960-3989982 GTTTTGCAAAATACTAACATTGG + Intronic
1051448946 9:17173862-17173884 GTTTTGCAAGATGTTATTATTGG - Intronic
1051683525 9:19632722-19632744 GTTGTGCAAGATGTTATCATTGG - Intronic
1051963052 9:22791348-22791370 GTTTTGCAAAATGTTAACACTGG + Intergenic
1052643645 9:31203002-31203024 ATTTTGCAGCATGTTACAATTGG + Intergenic
1052727199 9:32243292-32243314 GTTGTGCAAAATGTTAACATTGG + Intergenic
1053370155 9:37553979-37554001 GTTTTGCAAAATGTTACCATTGG - Intronic
1053504882 9:38633776-38633798 GTTTTGCAAAATGTTACCATTGG - Intergenic
1055741980 9:79399527-79399549 GTTTTACATGATGTTAGCATTGG + Intergenic
1056606123 9:88086855-88086877 GTTTTACAAGATGTTACCATTGG - Intergenic
1057073598 9:92121905-92121927 GTTTTGCAAGATGTTAACACTGG - Intergenic
1058741979 9:107952709-107952731 GTTTTGCAAGATGTTACCATTGG + Intergenic
1058834124 9:108846038-108846060 GTTTTGCAAGATGTTACCACTGG - Intergenic
1059179936 9:112202050-112202072 GTTTTTGAGAATGTTAACAACGG - Intergenic
1059315800 9:113424881-113424903 GTTTTGCAGCATTGTACCAGGGG - Intronic
1061628101 9:131854063-131854085 GTTATGCAAGATGTTAATATCGG + Intergenic
1186043393 X:5506559-5506581 GTTTTGCAAGATGTTACCATTGG - Intergenic
1186054958 X:5640581-5640603 GTTATGCAGGATGCTACCATTGG + Intergenic
1186580678 X:10814510-10814532 ATTTTGCAAAATGTTACCATAGG - Intronic
1187118410 X:16378676-16378698 GTCATGCAAGATGTTAACATTGG + Intergenic
1187186396 X:16990746-16990768 GTTTTACAAGATGTTACCATTGG + Intronic
1187539431 X:20177242-20177264 GTTTTGTAAGATGTTACCATTGG - Intronic
1188217756 X:27500088-27500110 GTTTTGCAAGATGTTAACATTGG + Intergenic
1188535363 X:31190767-31190789 GTTATGTAAGATGTTAACATTGG - Intronic
1188723794 X:33555135-33555157 ATTTTACGTCATGTTAACATTGG + Intergenic
1188875497 X:35425696-35425718 GTTTTGCAAGATGTTATCATTGG + Intergenic
1189419966 X:40848154-40848176 GTTTGCCAAAATGTTAACATTGG - Intergenic
1189426597 X:40907323-40907345 GTTTTGCAAGATATTACCATTGG + Intergenic
1189506227 X:41614072-41614094 GTTTTGCAAGATGTTACTATTGG - Intronic
1189520840 X:41765986-41766008 GTTTTGCAGAATGTTAATTTTGG + Intronic
1189697749 X:43682698-43682720 CTTTTACAGTATGTTAAGATGGG + Intronic
1189863140 X:45293988-45294010 GTGTTTGAGCATGTTAAAATTGG - Intergenic
1189929840 X:45997220-45997242 GTTTTGCAAAATATTACCATTGG - Intergenic
1189964295 X:46355735-46355757 CTTTTGCAAAATGTTATCATTGG + Intergenic
1190104810 X:47552145-47552167 GTTTTGCAATATGTTATTATGGG + Intergenic
1190156940 X:48001653-48001675 TTTTTGCAGGATGTTATCATTGG + Intronic
1190892344 X:54581155-54581177 GTTTTACAAGATGTTACCATTGG - Intergenic
1191659996 X:63639461-63639483 GTTTTGCAAAATGTTACCATTGG - Intronic
1191700906 X:64041751-64041773 GTTTTGCTTCATTTTAATATAGG - Intergenic
1191721492 X:64232350-64232372 GTATTGCAGGATGTTAGCATTGG - Intergenic
1192197750 X:69041066-69041088 TTTTTGCAAGATATTAACATTGG - Intergenic
1192912806 X:75623023-75623045 GTTTTGCAAAATTTTACCATTGG + Intergenic
1193083874 X:77430751-77430773 GTTTTGCAAGATGTTACCATTGG - Intergenic
1193602101 X:83520096-83520118 GTTTTGCAATATGTTACTATTGG + Intergenic
1193650948 X:84131073-84131095 GTTTTGCAAGATTTTACCATGGG - Intronic
1195911450 X:109892024-109892046 GTTTTCCAAAATGTTACCATTGG - Intergenic
1196556319 X:117088722-117088744 GTTTTGCAAGATGTTACCATTGG + Intergenic
1196759490 X:119188652-119188674 GTTTTGCATGATTTTATCATTGG + Intergenic
1197411857 X:126125420-126125442 GATTTGCAAGATGTTACCATTGG - Intergenic
1197686832 X:129449075-129449097 GTTTTGCAAAATGTTACTATTGG + Intronic
1197925388 X:131641832-131641854 GTTTTGCAGGTTGTTACCATTGG + Intergenic
1198380768 X:136081326-136081348 GTTTTGAAACATGTTAAGTTTGG - Intergenic
1198589989 X:138168035-138168057 GTTTTGCAAGATGATAGCATTGG - Intergenic
1198727770 X:139694966-139694988 GTTTTGCAAGATGTTACCATTGG + Intronic
1199239644 X:145531268-145531290 GTTTTGAAGGATGTTAGAATTGG + Intergenic
1199652004 X:149954530-149954552 GTTAGGCAAGATGTTAACATTGG - Intergenic
1199749937 X:150806121-150806143 GTTTTGCAGGATGTTACCACTGG + Intronic
1199932785 X:152541301-152541323 CTTTTGCAAAATGTTACCATCGG - Intergenic
1200351929 X:155506126-155506148 GTTTAGAAGGATCTTAACATGGG + Intronic