ID: 1074520956

View in Genome Browser
Species Human (GRCh38)
Location 10:114223414-114223436
Sequence CTGGAGCCCAAGATTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 6, 3: 22, 4: 269}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074520956_1074520960 2 Left 1074520956 10:114223414-114223436 CCTTCCTCAATCTTGGGCTCCAG 0: 1
1: 0
2: 6
3: 22
4: 269
Right 1074520960 10:114223439-114223461 GCGTTTCAAAACCCCCCATCTGG No data
1074520956_1074520966 23 Left 1074520956 10:114223414-114223436 CCTTCCTCAATCTTGGGCTCCAG 0: 1
1: 0
2: 6
3: 22
4: 269
Right 1074520966 10:114223460-114223482 GGATCCCAAACCTCTCACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074520956 Original CRISPR CTGGAGCCCAAGATTGAGGA AGG (reversed) Intronic
900726189 1:4217892-4217914 CTGCAGACCAAGAGTGAGGGAGG + Intergenic
900954492 1:5878118-5878140 CTGGTGCCAGAGAGTGAGGAAGG - Intronic
902994346 1:20212156-20212178 CTGTTGCCCACGATTGTGGAGGG - Intergenic
903058651 1:20654324-20654346 CTGGAGCCCAGCAATGAGGAGGG + Exonic
905642005 1:39596539-39596561 CCTGAGCAGAAGATTGAGGAAGG + Intergenic
907044085 1:51289098-51289120 CTGGAGCCCAAGGTACAGGATGG - Intronic
909603933 1:77489838-77489860 CTGGAGCCAAAGATTGACATGGG - Intronic
909877547 1:80828158-80828180 ATGGAGGCCCAGATTGAGGGTGG - Intergenic
911487104 1:98515951-98515973 GTGCAGCCTATGATTGAGGAAGG - Intergenic
912632326 1:111256498-111256520 CTGGTGCCCAGGATAGAGGTGGG - Intergenic
913316977 1:117561769-117561791 CAGAAGCCAAAGATGGAGGATGG + Intergenic
913536229 1:119775316-119775338 CTGGAGCCTGAGGTGGAGGATGG + Intergenic
914409501 1:147412394-147412416 TTGGAGCCCAAGAAAGAGAAGGG - Intergenic
915076281 1:153310618-153310640 CTGGAGACCCAGAATGAAGAAGG + Exonic
915247801 1:154568527-154568549 CTGGAGCCCAATGTGGGGGATGG - Intronic
915347219 1:155203637-155203659 CTGGAGCCCCAGAATAAAGATGG + Intronic
915348088 1:155208194-155208216 CTGGAAGCCACGATTGTGGAAGG + Intronic
918613078 1:186513853-186513875 GTGGAGCCCAAGACTTAGGAGGG - Intergenic
920170599 1:204070087-204070109 CTGGAGACCAGGATGGAGGAGGG + Intergenic
921360654 1:214328738-214328760 CTGAAGCCCAAGATGCAGGCAGG + Intronic
923126193 1:231036643-231036665 CTGGAGCCCAGGGCTGAGAAGGG - Intronic
924440782 1:244083456-244083478 GTGGAGCTCCAGATTCAGGAAGG + Intergenic
1064276812 10:13913897-13913919 CTGTAGCTCAGGATAGAGGACGG + Intronic
1064803504 10:19103625-19103647 CTGGAGCTCAGGATGGAGCATGG + Intronic
1065200008 10:23303875-23303897 GTGGAGCCCAAGACTGAGGAGGG + Intronic
1065721450 10:28631840-28631862 CTTGAGCCCAGGAATGAGGTTGG + Intergenic
1068201173 10:53786293-53786315 CTGGATCTCAGGACTGAGGAGGG - Intergenic
1069301458 10:66913388-66913410 CTGTAGCCCAAGGTTGAAAATGG - Intronic
1069775582 10:70925398-70925420 CTGGAGCTCAAGAGAGATGAGGG + Intergenic
1070410150 10:76132239-76132261 TTGGAGCCCAAGAAGCAGGAAGG + Intronic
1070560243 10:77560871-77560893 CTGGAGCCTCAGCTTGAAGAAGG - Intronic
1071000650 10:80827484-80827506 GTGGAACCCAAGACTTAGGAGGG + Intergenic
1071983899 10:91031675-91031697 CTGGAGCACAGGAATGAGCATGG - Intergenic
1074101576 10:110358284-110358306 CCAGAGCCCAAGAGTGAGGTTGG - Intergenic
1074520956 10:114223414-114223436 CTGGAGCCCAAGATTGAGGAAGG - Intronic
1075532303 10:123240005-123240027 CTGGAGCCCAGCATTGAGCCTGG - Intergenic
1076445810 10:130513058-130513080 CTGGTGCCCAGGGTTGAGGTGGG + Intergenic
1076888800 10:133274284-133274306 CTGGCCCCCAGGATTGAGGTGGG - Intronic
1078865849 11:15296663-15296685 CTGGACCACAATGTTGAGGATGG + Intergenic
1079456753 11:20642985-20643007 CTGGACCCCAAGCTGTAGGAAGG - Intronic
1080753935 11:35177329-35177351 TTGGAGCCATAGTTTGAGGAAGG - Intronic
1081402754 11:42661874-42661896 CAGGAGCCCACGGCTGAGGAGGG - Intergenic
1083783466 11:64930403-64930425 CTGGAGCTCAGGATTCTGGAAGG + Intronic
1084898806 11:72294570-72294592 CTGGAGCCTAAGGTTGGGGGAGG - Intronic
1086218785 11:84416102-84416124 CTGGAGCACAAAATGGAGAAGGG - Intronic
1086515198 11:87603940-87603962 ATGGAGCCCAAGACAGAGGAGGG + Intergenic
1088469707 11:110179053-110179075 GTGGAGCACAATTTTGAGGAGGG + Intronic
1091131017 11:133147349-133147371 CTGGAGGCCAAAGTTGAGAAAGG + Intronic
1091548290 12:1518951-1518973 CTGGAGCCCAGGACTGGGTAGGG + Intergenic
1091694924 12:2622066-2622088 CTGGAGGCCAAGAGCCAGGAAGG + Intronic
1092584112 12:9878731-9878753 CTGGCGCCCAGGATGGAGGGTGG + Intergenic
1094674475 12:32605367-32605389 CAGGAGCCCAATATTCAGTAAGG - Intronic
1096004906 12:48161637-48161659 CTGGACACCCAGATTCAGGAGGG + Intronic
1096112527 12:49037982-49038004 GTGAAGCCCAAGGTGGAGGAGGG - Exonic
1096215033 12:49793840-49793862 CGGGAGCCCAAGCCTGAGTACGG - Exonic
1096572604 12:52532473-52532495 CTGGGGCCAAGGCTTGAGGAGGG - Intergenic
1096718729 12:53505968-53505990 CTGGAGAGCAAGAGAGAGGAGGG - Intronic
1097515030 12:60594279-60594301 CTGGCGCCCAAGACAGAAGATGG - Intergenic
1098135390 12:67396558-67396580 CTGTAGCCCAGGCTTGAGTACGG + Intergenic
1098292392 12:68968889-68968911 CTAAAGCTCCAGATTGAGGATGG - Intronic
1098343051 12:69470896-69470918 CTGGAGCCCAAGATTGAGTCTGG - Intronic
1098659525 12:73075041-73075063 GTGGAGTCCAAGATGTAGGATGG + Intergenic
1099244958 12:80183581-80183603 CTGGAGCTCAAGAAAGAGAATGG + Intergenic
1101549474 12:105748688-105748710 TGGGAGCCCAAGATAGAGAAGGG - Intergenic
1102746546 12:115253720-115253742 CTGGAGCTCAGCATTCAGGAAGG + Intergenic
1103262971 12:119604713-119604735 CTTGAGCCAGAGATTGAGGCTGG - Intronic
1103494740 12:121352828-121352850 CTCGAGCCCAGGATTTGGGAGGG - Intronic
1104715429 12:131013082-131013104 CTGAAGGGCAAGATTGAAGAAGG - Intronic
1106801842 13:33263999-33264021 CTGCATCCCAAGAGTGAGCAAGG - Intronic
1107988863 13:45799584-45799606 CTGGAGCTCAGGATGGAGGATGG + Intronic
1109326710 13:60876690-60876712 CAGGAGCCCAAGGTAGAGAAGGG - Intergenic
1112239357 13:97665669-97665691 CTGGAGAACAAGAGTGAAGAGGG + Intergenic
1114195756 14:20474845-20474867 CTGAACCCCAAGTTTGAGGTTGG + Exonic
1114628438 14:24144425-24144447 CTGATCCCCAAGATTGAAGATGG - Exonic
1115365965 14:32557335-32557357 TAGGAGGCCAAGATGGAGGATGG - Intronic
1115458091 14:33628763-33628785 CAGGAGCCCAGGCTTAAGGAAGG - Intronic
1116137222 14:40941947-40941969 CTGGTTCCCAAGATTATGGAGGG - Intergenic
1116596543 14:46855531-46855553 CTGGTTTCCAAGATGGAGGAAGG + Intronic
1116962693 14:50982492-50982514 CTAGAGTCCTAGATGGAGGAGGG + Intronic
1118422186 14:65618859-65618881 ATAGAGCCCAAGACTCAGGAGGG - Intronic
1119776474 14:77252229-77252251 CTGGAGGCCAAGAGAGAGGATGG + Intronic
1120261463 14:82190266-82190288 GTAGAGCCTAAGATTGACGAGGG - Intergenic
1120655859 14:87189155-87189177 CTGTAGGTCAAGGTTGAGGATGG - Intergenic
1121496410 14:94394599-94394621 CTGGAGTCTAACACTGAGGAGGG + Intergenic
1122077813 14:99246816-99246838 GAGGAGGCCAAGCTTGAGGAGGG + Intronic
1125771340 15:42168423-42168445 CTGGAGCCCAATGTCAAGGAAGG + Intronic
1126552386 15:49947083-49947105 CTGGAGCCCCAGTTTGAGCTGGG + Intronic
1126577247 15:50209335-50209357 CTGGGGCCCAAGACAGAGGGAGG + Intronic
1127417636 15:58772204-58772226 CAGGAGCAAAACATTGAGGATGG - Exonic
1128476555 15:68001694-68001716 CTGGAGCACAAGAGAGATGAGGG + Intergenic
1128878769 15:71224113-71224135 GCAGAGCCCAAGAGTGAGGAGGG + Intronic
1129009833 15:72405520-72405542 CTAGAGCCAAAGATGGAAGAAGG + Intronic
1130190296 15:81728358-81728380 CTGGAACACAATATTGAGGTTGG - Intergenic
1131223371 15:90603853-90603875 CTGGATCCCAAGATTCTTGAGGG - Intronic
1132460932 16:54150-54172 CTGCGGCCCAAGGCTGAGGAAGG + Intronic
1132463286 16:66101-66123 GTGGAGACCCAGATTGAGAAGGG + Intronic
1132869251 16:2108379-2108401 CTGGTGCCCATCATTGAGGGTGG - Exonic
1132883734 16:2173384-2173406 CTGGAGCTCAAGTTTGGTGAGGG + Exonic
1133144615 16:3775284-3775306 CAGGAGGCTAAGGTTGAGGACGG - Intronic
1133328345 16:4956117-4956139 CTGCTGCCCAACATTGAGGGAGG - Intronic
1133673765 16:8049767-8049789 ATGGAACCCAACATTGAGAAAGG + Intergenic
1133829066 16:9305073-9305095 GTGGAGCCCAAAAATGAGGCTGG + Intergenic
1136999517 16:35216786-35216808 CAGGAGCCCAGGAAAGAGGAAGG - Intergenic
1137003433 16:35251220-35251242 CAGGAGCCCAGGAAAGAGGAAGG + Intergenic
1137270248 16:46898262-46898284 CAGGAGCTCCAGATTGGGGACGG + Intronic
1137497226 16:48979891-48979913 CTGAAGAACAAGATTGAGCAGGG + Intergenic
1139632510 16:68239129-68239151 CTGGAGCCCTAGATAGAGAAGGG - Intergenic
1139961526 16:70720804-70720826 CTGGAGCTCAAGACTGGGGCCGG + Intronic
1140259056 16:73361634-73361656 AAGGAGACCAAGATTGGGGATGG - Intergenic
1140887075 16:79253635-79253657 GTGGAGCCCAAGATGAAGAAAGG - Intergenic
1141786044 16:86201498-86201520 CTGGAGGCCAGGCTTGAGAAGGG + Intergenic
1142127162 16:88415880-88415902 CTGCCGCCCCAGCTTGAGGAAGG - Intergenic
1142223895 16:88868078-88868100 CCCCAGCCCAAGATGGAGGAAGG - Intergenic
1203143106 16_KI270728v1_random:1781825-1781847 GTGGATCCCCAGATGGAGGATGG + Intergenic
1146955233 17:36933397-36933419 CTGGAACCGAAGAGAGAGGAGGG + Intergenic
1147459005 17:40556780-40556802 CTGGGGGTCAAGGTTGAGGAGGG + Intronic
1147768488 17:42852172-42852194 CTGGAGGCCCAGTTTGAGGCCGG + Exonic
1147771076 17:42868104-42868126 CTGGAGGCCCAGTTTGAGGCCGG + Intergenic
1147916205 17:43888422-43888444 ATGGAGCCCCAGAGTGAGGGAGG + Intronic
1148198590 17:45732812-45732834 CTGGGACCCATGGTTGAGGATGG + Intergenic
1148693483 17:49545918-49545940 AGGGAGCCCAAGCTTGGGGATGG - Intergenic
1150266135 17:63833537-63833559 CTGGGGCCCAGGATTGGGGTGGG - Intronic
1152037134 17:77880421-77880443 CTGGAGCCCAAGTAGGAGGGAGG - Intergenic
1152472551 17:80498500-80498522 CTGGTGCCCAGCTTTGAGGACGG - Intergenic
1153361463 18:4202340-4202362 CTGGAGCCTCAGAATGAGGAAGG + Intronic
1154069230 18:11138330-11138352 CTGTAGCCCAAGCTGGAGTACGG + Intronic
1154408385 18:14118564-14118586 GTGGAGCCAAAGATCAAGGAGGG + Intronic
1155327129 18:24675743-24675765 GTGGAGCCCAAGTTTCAGGTGGG - Intergenic
1159247335 18:65824739-65824761 ATGGAGTACAAGATTGTGGATGG + Exonic
1160006917 18:75074850-75074872 CTCCAGGCCAAGAGTGAGGATGG + Intergenic
1160808110 19:1001294-1001316 CTGCACCCCTAGAGTGAGGAGGG - Intronic
1160898794 19:1416364-1416386 CTGGAGACCAAGGGTGATGATGG + Intronic
1161241492 19:3225781-3225803 CTTGAGCCCAAGGTGGAGGCGGG - Intronic
1161496902 19:4591445-4591467 CTGGAGGCCAGGAAGGAGGAGGG + Intergenic
1161960653 19:7521106-7521128 CTGGAGCTCCAGATTGTGGCTGG - Intergenic
1163774887 19:19212193-19212215 GGGGAGCCCTAGGTTGAGGAGGG + Intronic
1164558702 19:29273545-29273567 CTGGAGCACATTATGGAGGAGGG - Intergenic
1164756657 19:30694881-30694903 GTGGAGGGCAAGAGTGAGGAGGG + Intronic
1165756216 19:38294688-38294710 CTGGTCCACAAGCTTGAGGAAGG + Intronic
1165900581 19:39167554-39167576 CTGGGGCCCAGGATGGAGGGCGG - Intronic
1166338262 19:42121976-42121998 TGGGAGCCCAAGAGTGAGAAGGG + Intronic
1166620416 19:44294347-44294369 CTGGCTCCCAAGATTGAGCCAGG + Intronic
1167027099 19:46928539-46928561 CTGGAGCCAAACAGCGAGGAGGG - Intronic
1167613684 19:50519330-50519352 CTGGTGCGCAAGATCGAGGTGGG - Exonic
1167766207 19:51484280-51484302 CTGGACTACAAGATTCAGGAGGG + Intronic
1168266694 19:55227439-55227461 CTGGAGCACAAGGCTGAGGTAGG + Exonic
926408712 2:12579988-12580010 CTGGAGCCTAAGAGTGAATAAGG + Intergenic
926512858 2:13803792-13803814 CTGGAGTCCAAGAGTGAGAGAGG - Intergenic
928094594 2:28395957-28395979 CTTGAGCCCAAGATCGGGCAAGG - Intronic
929567522 2:42999197-42999219 TTGGAGACCAAGATAGAGGGAGG + Intergenic
931396823 2:61895318-61895340 GTGGAGCCCAAGATCCAGGAAGG + Intronic
935607187 2:104982972-104982994 CTGGTGGCCAAGTTTGAGGCAGG + Intergenic
937079531 2:119130462-119130484 CAGGAGAGCAAGACTGAGGATGG - Intergenic
938083242 2:128381298-128381320 CTGGAGACCAGGCCTGAGGAGGG + Intergenic
939377037 2:141381948-141381970 GTGGAGCCCAGGATCTAGGAAGG + Intronic
941580902 2:167294023-167294045 CTGGAGCGCAGACTTGAGGATGG + Intergenic
942245492 2:174004144-174004166 GGGGAGCCCAATAGTGAGGAGGG + Intergenic
944366665 2:198928954-198928976 CTGGAGCCCATGAGGCAGGAGGG - Intergenic
946101992 2:217333284-217333306 CAGGAGCTAAATATTGAGGATGG + Intronic
946896085 2:224326005-224326027 CTCCAGCCCAGGATTCAGGAGGG - Intergenic
947709090 2:232300396-232300418 CTGGAGACCAAGAGTGGGGAGGG - Intronic
947923796 2:233903317-233903339 AAGGAGCCCAAGATCTAGGATGG + Intergenic
948230997 2:236349220-236349242 ATGGAGCTGAAGAGTGAGGAGGG + Intronic
948443377 2:238012760-238012782 CTGGTGCCCTAGGTGGAGGAAGG + Intronic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169232957 20:3905026-3905048 CTGGAGCCCCAGAATCAGGATGG - Intronic
1170890128 20:20368988-20369010 CTGGGGCTCAAGATCAAGGAGGG + Exonic
1172612544 20:36262586-36262608 CTGGTGCTCCAGACTGAGGAAGG - Intronic
1173645831 20:44632579-44632601 CTGGAGCCCAAAGTTGAAGCAGG + Intronic
1173858509 20:46266853-46266875 CTGGAGCCCCAGATTCAGTAAGG + Intronic
1174114844 20:48219818-48219840 CAGGAGGCCAAGATGGATGAGGG + Intergenic
1175390974 20:58627206-58627228 CTGTAGTGCAAGATGGAGGAGGG + Intergenic
1178018556 21:28380897-28380919 CCGATGCCCAAGATTCAGGAAGG - Intergenic
1178279730 21:31271122-31271144 CTAGAGCCTAAGCTTCAGGAGGG + Intronic
1179085025 21:38208230-38208252 CTGGAGCCCAGGAAGCAGGAAGG - Intronic
1179907040 21:44427797-44427819 CTGGAGCCGGAGGTTGAGTAAGG + Intronic
1180049679 21:45325464-45325486 CTGGCGCCCAAGCTTGTGGGAGG + Intergenic
1180854277 22:19036508-19036530 CTGGAGCACAAGGTTCAGCAAGG + Exonic
1180883254 22:19221567-19221589 CTGGAGTCCCAGATTCAGGAAGG - Exonic
1182959870 22:34462203-34462225 GTGCAGCCCATGATTGATGATGG + Intergenic
1183383309 22:37501344-37501366 CTGCAGCCCAAACTGGAGGAAGG + Intronic
1185302572 22:50090164-50090186 CTGGAGCCCGAGCTCGCGGAAGG + Exonic
949615759 3:5752164-5752186 CTGGATCTCCAGCTTGAGGACGG + Intergenic
949731511 3:7118351-7118373 CTGTTGCCCAAGCTGGAGGATGG - Intronic
949885465 3:8689732-8689754 CTCAAAGCCAAGATTGAGGACGG - Intronic
949905088 3:8852480-8852502 CTGGAGCCCTGGATTCTGGAGGG + Intronic
951059035 3:18183117-18183139 TTGGAGTCCCAGATTGAGGGTGG - Intronic
952395392 3:32916471-32916493 CTTGAGCCCAGGAGGGAGGAGGG + Intergenic
952443709 3:33359734-33359756 CAGAAGCCCAAGAGTGAGGCTGG + Intronic
954435761 3:50495131-50495153 CTGAGGCCCAAGATGGGGGAAGG - Intronic
954607925 3:51928511-51928533 CTGGAGCCCAGAATGGAGGGAGG + Intergenic
954661435 3:52228949-52228971 CTGGAGCCCAGGAAGGAGGATGG + Exonic
955520132 3:59767597-59767619 CTGGAGCCCAACATTAAGGATGG + Intronic
957043521 3:75355892-75355914 CTCAAAGCCAAGATTGAGGATGG + Intergenic
957199100 3:77108985-77109007 TGGGAGCCCAAGAGTGTGGAGGG + Intronic
957786838 3:84893496-84893518 CTTGAGTCCAAGATTCAGGTTGG - Intergenic
964837092 3:160950927-160950949 CTATAGCCCAAGATTCAGAAAGG + Intronic
969027073 4:4182248-4182270 CTCAAAGCCAAGATTGAGGACGG + Intergenic
969707390 4:8819227-8819249 CTGTAGCCCAAGAGGGAGAAGGG + Intergenic
970673129 4:18418419-18418441 CAGGAGCCCACGATGGAGGTGGG + Intergenic
970730050 4:19091963-19091985 CTGTATCCCAAGATCCAGGATGG - Intergenic
973195373 4:47433684-47433706 GTGGGGTCCAAGACTGAGGAGGG - Intergenic
974064241 4:57063014-57063036 CTGGAGCTCAGGGTTCAGGAGGG - Intronic
976604604 4:86970886-86970908 CTGGAGCAGAATGTTGAGGAGGG + Intronic
977034333 4:91930742-91930764 TTTGAGACAAAGATTGAGGATGG - Intergenic
978655557 4:111061676-111061698 CTGGGGACAAAGAATGAGGATGG + Intergenic
979801451 4:124914111-124914133 CAAGAGCCCAAGACAGAGGAAGG - Intergenic
980164113 4:129203545-129203567 TTAGAGACCAAGATTCAGGAAGG - Intergenic
980876811 4:138670082-138670104 CTGAAGCAGAAGATTGAGGCAGG + Intergenic
981997248 4:150988254-150988276 CTGGATCCCATTATTGAGCATGG + Intronic
983102609 4:163644309-163644331 GTGGAGCCCAAGACCTAGGAGGG + Intronic
983644862 4:169979423-169979445 CTTGATCTCAAGATTGAGAAGGG - Intergenic
986364026 5:7011666-7011688 CTGGAGCTCAAGTCTGAGCATGG - Intergenic
987031759 5:13982930-13982952 CAGGAGACCAAGGTTGTGGAGGG - Intergenic
987660923 5:20874691-20874713 CTGTAGTCCAAGATTGTGGCTGG + Intergenic
988762717 5:34330994-34331016 CTGTAGTCCAAGATTGTGGCTGG - Intergenic
988991147 5:36672158-36672180 CAGGAGCCCTAAATGGAGGAAGG + Intronic
989018646 5:36972574-36972596 CTGGAGCCAAAGATTGATTTAGG - Intronic
989111378 5:37909594-37909616 CTGGGGCTCATGATTGAGGCTGG + Intergenic
990254640 5:53954308-53954330 TTGGATCCCAAGACAGAGGAAGG - Intronic
992051800 5:72947977-72947999 CTGGAGCCCAGGACAGAGGTTGG - Intergenic
993065928 5:83096563-83096585 GTGGAGCCCAAGACTTAGGAAGG - Intronic
994324393 5:98432506-98432528 ATGGAGCCTAAGATAAAGGATGG + Intergenic
996031777 5:118713176-118713198 CTAGGGCCCAAGAATGAGAAAGG - Intergenic
996688716 5:126313938-126313960 CTGGATTCCAAGAGGGAGGAGGG + Intergenic
997471669 5:134120705-134120727 CTGGAGCCAAGGGATGAGGAGGG - Intronic
997835302 5:137187223-137187245 CTGGAGCTCAGGGTTGAGGTCGG - Intronic
1000810477 5:165855402-165855424 ATGGAGCCCAAGATAGAAGGAGG + Intergenic
1005802299 6:29439812-29439834 CAGGATCCCAAGAGTGAGCAAGG + Exonic
1008211679 6:48731939-48731961 GTGGAGCCCAAGGCTTAGGAGGG - Intergenic
1008927275 6:56900131-56900153 CTGGAGTTCTAGAATGAGGATGG - Intronic
1009557648 6:65194660-65194682 CTGTATCCCAAGTGTGAGGAGGG + Intronic
1013606866 6:111758766-111758788 CTGCAGCCCAGCATTTAGGACGG + Intronic
1015534931 6:134258183-134258205 CTTGAGCCCAGGAATGAGGAGGG - Intronic
1015603524 6:134933392-134933414 CTGGACACCAAGATGGAGCAGGG - Intronic
1017488178 6:154921789-154921811 ATGCAGCCCAAGAATGAGAAAGG - Intronic
1019053744 6:169205196-169205218 TTGGAGCCCAACACTGTGGAGGG + Intergenic
1019328741 7:452489-452511 CTGGCTGCCAAGAGTGAGGATGG - Intergenic
1019513370 7:1429365-1429387 CTGGAGCCCAAGACGCAGGGGGG - Intronic
1022124765 7:27345152-27345174 CTGGAGCCCAGCACTGAGGCTGG - Intergenic
1022388435 7:29923346-29923368 CAGGAGCCCAGGATGTAGGAAGG + Intronic
1023212931 7:37827738-37827760 CTGGAGCCCAGGGATAAGGAGGG - Intronic
1023411930 7:39896570-39896592 CTGGTGCCGAAGATTGGGAATGG - Intergenic
1024624927 7:51198891-51198913 GTAGAGCCCCAGACTGAGGAGGG + Intronic
1025663950 7:63572463-63572485 CTGCAGCCCAAGACTCAGGCTGG - Intergenic
1025860835 7:65326075-65326097 CAAAAGCCCAAGACTGAGGAGGG - Intergenic
1026962791 7:74419745-74419767 GTGGAGTGCAAGATTGAAGATGG - Intergenic
1028832705 7:95344430-95344452 CTGGACCCCAAGGATGAAGAAGG + Intergenic
1029077413 7:97946384-97946406 CTCAAAACCAAGATTGAGGAAGG + Intergenic
1029692740 7:102193048-102193070 CTGCAGCCCCAGGTTGGGGAAGG - Intronic
1030338960 7:108355976-108355998 CTGTTGCCCAAGCTGGAGGATGG + Intronic
1033097021 7:138441090-138441112 CTGGAGGCCAAGATGCAGCATGG + Intergenic
1033607861 7:142940589-142940611 CTGGAGCCCAGGAGGGAGGGAGG - Exonic
1033732613 7:144194720-144194742 TTGGAACCCAAGATCCAGGAAGG + Intronic
1033743464 7:144293300-144293322 TTGGAACCCAAGATCCAGGAAGG + Intergenic
1033750438 7:144356297-144356319 TTGGAACCCAAGATCCAGGAAGG - Intronic
1033848338 7:145462954-145462976 CTTGCCCCCAAGACTGAGGATGG - Intergenic
1034571231 7:151958325-151958347 CTGGTGCCCAAGGTGGAAGATGG - Intronic
1035297728 7:157876678-157876700 CTGCACCCCAAGAGTGAGGATGG + Intronic
1037272753 8:17147357-17147379 CTGCAGCCCAAGATGAATGATGG - Intergenic
1038167547 8:25100461-25100483 ATGGAGCCCAAGAATGGGCAGGG - Intergenic
1038323169 8:26548070-26548092 CTGATCCCCAAGATTGAGGATGG + Intronic
1038440446 8:27567650-27567672 CTGGGGCCAAATCTTGAGGAAGG - Intergenic
1039888177 8:41667275-41667297 CTGGAGTCTAAGGTTGAGGTAGG + Intronic
1045049458 8:98309593-98309615 CTAGAGAGCAAGCTTGAGGAGGG + Intergenic
1045298103 8:100889685-100889707 CTGGATCCCAAGCTTAAGGTGGG + Intergenic
1045566818 8:103325669-103325691 CTGAAGCTAAAGCTTGAGGAAGG - Intronic
1045661396 8:104441582-104441604 CTGGTGCCGAAGATGGAGGAAGG + Intronic
1047762759 8:127966495-127966517 CTGGGGCACAAGATGGGGGATGG + Intergenic
1048685025 8:136895106-136895128 CTGGAGCCCAGGACTGAGCCTGG + Intergenic
1048937913 8:139372268-139372290 CTAGAGCCAAGGTTTGAGGATGG + Intergenic
1048942674 8:139415371-139415393 CTGGAGCACAAGACAGAGCAGGG + Intergenic
1049499323 8:142953197-142953219 TTGGAGGCCAAGATGGCGGAGGG - Intergenic
1051741747 9:20259084-20259106 CTGGCTTCCAAGATGGAGGAAGG + Intergenic
1051963715 9:22800754-22800776 GTGGAGCCCAAGACTGAGGAAGG + Intergenic
1053185248 9:36010716-36010738 ATGGTCCCCAAGCTTGAGGATGG - Intergenic
1054804755 9:69387079-69387101 CTGGAGCCCTCCATTGTGGAAGG + Intronic
1058717884 9:107738738-107738760 CTGGAGGCCATGACAGAGGAAGG - Intergenic
1059588816 9:115635264-115635286 CAGGAGCACAAGACAGAGGAAGG - Intergenic
1059705997 9:116823836-116823858 CTGAAGTCCATGATAGAGGAAGG - Intronic
1062382654 9:136294858-136294880 CAGGACCCCAAGGTAGAGGAAGG + Intronic
1185841431 X:3395173-3395195 GTGAAGTCCAAGGTTGAGGAGGG - Intergenic
1186750761 X:12619488-12619510 GTGGAGCCCAAGACTGAGGAGGG + Intronic
1188055150 X:25531990-25532012 CTGGAACCCAGGATTGAGTGGGG - Intergenic
1188098324 X:26049823-26049845 GTGGAGTCCAAGATTTGGGAAGG - Intergenic
1189409399 X:40756281-40756303 GTGGAGCCCAAGACCTAGGAGGG - Intergenic
1191115125 X:56844445-56844467 GTGGATCCCAAGACTGAGGAGGG + Intergenic
1191218598 X:57960579-57960601 CTGGACCCCAAGACTTAGGAGGG - Intergenic
1191945665 X:66531815-66531837 GTGGAGCCCAAGACTGAGGAAGG - Intergenic
1192100743 X:68261719-68261741 CTGGAGCCAACGATAGATGAAGG - Intronic
1192506240 X:71685352-71685374 CTGGAGCCCGAGACTGTGGGGGG + Intergenic
1192520457 X:71796196-71796218 CTGGAGCCCGAGACTGTGGGGGG - Intergenic
1195801973 X:108722824-108722846 GTGGAGCCCAAGAGTGAGCCAGG + Intronic
1197732509 X:129823316-129823338 CTGGAGGGCAGCATTGAGGAAGG - Intronic
1199684971 X:150257643-150257665 CTGGAGAACAAGATGGAGAAGGG - Intergenic
1201227640 Y:11833695-11833717 CTGGACCACAAGATTCAAGAAGG - Intergenic
1201352116 Y:13055372-13055394 GTGGAGCCCAAGACCAAGGAGGG + Intergenic
1201942792 Y:19477794-19477816 CTGGAGGCCAAGAATTATGAGGG - Intergenic