ID: 1074522083

View in Genome Browser
Species Human (GRCh38)
Location 10:114235243-114235265
Sequence CACAGTCACTTTACTACAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074522076_1074522083 7 Left 1074522076 10:114235213-114235235 CCAGTAGGCAGGAGCCCCCTAAT No data
Right 1074522083 10:114235243-114235265 CACAGTCACTTTACTACAATGGG No data
1074522077_1074522083 -7 Left 1074522077 10:114235227-114235249 CCCCCTAATCTGAAGCCACAGTC No data
Right 1074522083 10:114235243-114235265 CACAGTCACTTTACTACAATGGG No data
1074522078_1074522083 -8 Left 1074522078 10:114235228-114235250 CCCCTAATCTGAAGCCACAGTCA No data
Right 1074522083 10:114235243-114235265 CACAGTCACTTTACTACAATGGG No data
1074522079_1074522083 -9 Left 1074522079 10:114235229-114235251 CCCTAATCTGAAGCCACAGTCAC No data
Right 1074522083 10:114235243-114235265 CACAGTCACTTTACTACAATGGG No data
1074522080_1074522083 -10 Left 1074522080 10:114235230-114235252 CCTAATCTGAAGCCACAGTCACT No data
Right 1074522083 10:114235243-114235265 CACAGTCACTTTACTACAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074522083 Original CRISPR CACAGTCACTTTACTACAAT GGG Intergenic
No off target data available for this crispr