ID: 1074524293

View in Genome Browser
Species Human (GRCh38)
Location 10:114250871-114250893
Sequence TGCAATCTGGAGGCTGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 374}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074524293_1074524300 22 Left 1074524293 10:114250871-114250893 CCCTGTCCAGCCTCCAGATTGCA 0: 1
1: 0
2: 3
3: 18
4: 374
Right 1074524300 10:114250916-114250938 ATCCTTGGGTTATACAGATGAGG No data
1074524293_1074524303 27 Left 1074524293 10:114250871-114250893 CCCTGTCCAGCCTCCAGATTGCA 0: 1
1: 0
2: 3
3: 18
4: 374
Right 1074524303 10:114250921-114250943 TGGGTTATACAGATGAGGCAGGG No data
1074524293_1074524298 7 Left 1074524293 10:114250871-114250893 CCCTGTCCAGCCTCCAGATTGCA 0: 1
1: 0
2: 3
3: 18
4: 374
Right 1074524298 10:114250901-114250923 GCACTTGTTCTGATCATCCTTGG No data
1074524293_1074524302 26 Left 1074524293 10:114250871-114250893 CCCTGTCCAGCCTCCAGATTGCA 0: 1
1: 0
2: 3
3: 18
4: 374
Right 1074524302 10:114250920-114250942 TTGGGTTATACAGATGAGGCAGG No data
1074524293_1074524299 8 Left 1074524293 10:114250871-114250893 CCCTGTCCAGCCTCCAGATTGCA 0: 1
1: 0
2: 3
3: 18
4: 374
Right 1074524299 10:114250902-114250924 CACTTGTTCTGATCATCCTTGGG No data
1074524293_1074524304 28 Left 1074524293 10:114250871-114250893 CCCTGTCCAGCCTCCAGATTGCA 0: 1
1: 0
2: 3
3: 18
4: 374
Right 1074524304 10:114250922-114250944 GGGTTATACAGATGAGGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074524293 Original CRISPR TGCAATCTGGAGGCTGGACA GGG (reversed) Intronic
900302552 1:1985445-1985467 TGCAAACAGGCGTCTGGACACGG + Exonic
900718601 1:4160774-4160796 TGAAATCTGCAGGCTGGAAGCGG + Intergenic
900860118 1:5222970-5222992 TGCAAGGTGGAGGGTTGACAGGG + Intergenic
900947882 1:5841392-5841414 AGCAAGTTGGAGGCTGGGCACGG + Intergenic
902229174 1:15016574-15016596 TGCATTCTCAAGGCTGGGCACGG - Intronic
902956422 1:19926979-19927001 TGCAAAATGGAGGCTGCAAAAGG + Intergenic
902957009 1:19932271-19932293 TGCAAAATGGAGGCTGCAAAAGG + Intergenic
903867680 1:26410899-26410921 TGCAAACTGCTGGTTGGACACGG - Exonic
903884937 1:26535626-26535648 TGAAGTCTGGGGGCTGGAAAAGG + Intronic
904242440 1:29156843-29156865 TGCAAAATGGAGGCTGCAAAAGG + Intronic
904832851 1:33316504-33316526 TGAAATCTGGAGCCTGGCCATGG + Intronic
905346709 1:37316117-37316139 TCCTACCTGGAGGCTGGCCAAGG - Intergenic
905441336 1:37998098-37998120 TGGAATATGGAGGCCAGACATGG - Exonic
905887021 1:41496887-41496909 CGCAAGCTGGAGGCAGGACTTGG - Intergenic
906068553 1:43000433-43000455 AGTCATCTGGGGGCTGGACATGG - Intergenic
906426542 1:45718617-45718639 TATACTCTGGAGGCTGGGCAAGG - Intronic
906982751 1:50649070-50649092 ATGAATCTGAAGGCTGGACACGG - Intronic
907583387 1:55592283-55592305 TGCAGCCTGGAAGGTGGACATGG + Intergenic
910278843 1:85476150-85476172 AACTATCTTGAGGCTGGACATGG - Intronic
910525475 1:88172953-88172975 TTCAAGCTGGAGCCAGGACATGG - Intergenic
911633977 1:100213332-100213354 TACAACCTGGAGGCCGGCCAGGG + Intronic
912387239 1:109277606-109277628 TGCCACCTGGCGGCTGGAGAGGG - Intergenic
912995211 1:114526399-114526421 TGTAATATGTAGGCCGGACAAGG + Intergenic
914440425 1:147700673-147700695 TGCAAACAGGTGGCTGTACAGGG + Intergenic
915409840 1:155691940-155691962 TGCAAAATGGAGGCTGCAAAAGG + Intronic
915410644 1:155699089-155699111 TGCAAAATGGAGGCTGCAAAAGG + Intronic
915490611 1:156248125-156248147 TGCTCCCTGGAGGCTGGACAAGG - Intergenic
915842727 1:159229095-159229117 TGCAAGCTGGAGACAGGACTCGG + Intergenic
916159668 1:161896385-161896407 TCCAATATGGAGGCTGGGCATGG - Intronic
916890875 1:169111231-169111253 TGCACTCTTGACGTTGGACAAGG + Intronic
919643137 1:200065073-200065095 AGAAATCTGAAGGCTGGGCATGG - Intronic
919847492 1:201650791-201650813 GGCAATCAGGAGACTGGACAAGG + Intronic
921165812 1:212506200-212506222 TACAAACTGGGGGCTGGCCATGG - Intergenic
921181373 1:212634223-212634245 AGAAATCTGGAGGCTGGGCGTGG - Intergenic
921228532 1:213045226-213045248 TGCAAAATGGAGGCTGCAAAAGG + Intergenic
921454404 1:215350461-215350483 TGCCCTGTGGAGCCTGGACACGG + Intergenic
923238185 1:232055434-232055456 TGAAAGCAGGAGGCTGAACAAGG - Intergenic
923608130 1:235463855-235463877 TGAAATTGGGAGGCTGGGCACGG - Intronic
923670887 1:236040307-236040329 TGCCATTTGGTGGCAGGACAAGG - Intronic
924623779 1:245684337-245684359 TGCAATCTGGATGGTGGACAGGG - Exonic
1062790036 10:297653-297675 TGCATACTGGAGGCTGGGAAGGG + Intronic
1062841128 10:672816-672838 TAGAATCAGGAGGCTGGGCAGGG - Intronic
1063646465 10:7888527-7888549 TGCAGTGTGGAGGGTTGACAGGG + Intronic
1063872153 10:10429449-10429471 TGCCATCTGTAGGCTGAACCTGG - Intergenic
1064578202 10:16767142-16767164 TGGTAGCTGGAGGGTGGACAGGG - Intronic
1065769754 10:29066901-29066923 TGGAATCTGGAGTGGGGACATGG - Intergenic
1066263464 10:33752008-33752030 TACAAGGTGGAGGCTGGGCATGG + Intergenic
1067012063 10:42723730-42723752 TGGTAGCTGGAGGGTGGACAGGG + Intergenic
1067216571 10:44309145-44309167 TGTAAACTGGAGCCTGGACCAGG - Intergenic
1067311530 10:45118155-45118177 TGGTAGCTGGAGGGTGGACAGGG - Intergenic
1068630885 10:59296193-59296215 TACCATCTTGAGGCTTGACATGG + Intronic
1070324023 10:75376038-75376060 TGTATTCTGGAGGCTAGAGATGG - Intergenic
1070432430 10:76354271-76354293 TGTGATATGGAGGCTGAACAGGG + Intronic
1070592185 10:77809114-77809136 ATCAATCCTGAGGCTGGACACGG + Intronic
1071859818 10:89660991-89661013 TGAAAACTGGTGGCTGGGCACGG + Intergenic
1072442430 10:95468805-95468827 TGCAGGCTGGGGGCCGGACAGGG + Intronic
1073154373 10:101334820-101334842 TGGAATTTGGAGGCCGGACACGG - Intergenic
1073878121 10:107949490-107949512 TGCAAGCTGCTGGCTGGGCATGG + Intergenic
1073976194 10:109104311-109104333 TGCCATCTGCAAGCTGGAGAAGG + Intergenic
1074087292 10:110218158-110218180 TGGAATCTGGAGGCTGGGCACGG + Intronic
1074524293 10:114250871-114250893 TGCAATCTGGAGGCTGGACAGGG - Intronic
1075701310 10:124470843-124470865 TGCAACCTGGACCTTGGACAAGG + Intronic
1076203171 10:128573862-128573884 TGCAAACTGGAGCCTGGTCTGGG + Intergenic
1077025811 11:439394-439416 CCCAACCTGGAGGCTGGACTGGG - Intronic
1077345003 11:2043329-2043351 TGCAGTATGGAGTCTGGAGAAGG - Intergenic
1077990897 11:7411143-7411165 AGCAATCTTGAGGCCGGGCATGG - Intronic
1078369940 11:10736062-10736084 TGTGATCTGGAGGCTGGAACAGG + Intergenic
1078647845 11:13158761-13158783 TGCAAGCAAGAGGCTGGACGCGG + Intergenic
1078731310 11:13976826-13976848 TGCAACATGGAGGCAGAACAAGG - Intronic
1080344855 11:31312863-31312885 TGCAGTATATAGGCTGGACATGG + Intronic
1081508883 11:43747845-43747867 TGCAAAATGGAGGCTGCAAAAGG - Intronic
1082109757 11:48261454-48261476 TGCATTCTGGAAGCTGGATTTGG + Intergenic
1082260319 11:50072892-50072914 TGCAAGGTGGAGGCTGGGCCTGG + Intergenic
1083225629 11:61282727-61282749 GCCAATCAGGAGGATGGACAGGG - Intronic
1084123104 11:67081089-67081111 AGCCAGCTGGAGGCCGGACATGG - Intergenic
1084538621 11:69773720-69773742 TGCGGGCTTGAGGCTGGACACGG - Intronic
1084574890 11:69982733-69982755 TCCAGGCTGGAGGCTGGACCTGG + Intergenic
1084603749 11:70161144-70161166 TGCAATCTGCAGGGGGGAAAGGG - Exonic
1087238753 11:95751524-95751546 GGCATTCTGGAAGCAGGACAGGG + Intergenic
1088299763 11:108344590-108344612 TGCAAACTGGAGGCATGAGATGG + Intronic
1089960984 11:122617128-122617150 CTGATTCTGGAGGCTGGACATGG - Intergenic
1090205117 11:124879641-124879663 TGCACTCTGGGGGCTGGAGGAGG + Intronic
1091269406 11:134295642-134295664 TGCAATCTGAAGGCAGCAGAAGG - Intronic
1091296902 11:134480327-134480349 TCCACACTGCAGGCTGGACAAGG + Intergenic
1202827935 11_KI270721v1_random:98202-98224 TGCATTATGGAGTCTGGAGAAGG - Intergenic
1092871581 12:12810401-12810423 TGCAAAATGGAGGCTGCAAAAGG + Intronic
1093489590 12:19689542-19689564 TGGAATCTTGAGGGTGGAAATGG - Intronic
1096954570 12:55512742-55512764 TGGAATTTGGAGGCAAGACATGG - Intergenic
1098139266 12:67435071-67435093 AGCAATCTGTAGGCTGCAGATGG - Intergenic
1098824460 12:75276114-75276136 GACAATCTGCAGGGTGGACATGG - Exonic
1099014498 12:77327985-77328007 TGCAAGCTGAAGTGTGGACATGG + Intergenic
1101139386 12:101779475-101779497 TGGACTCTGGAGGCTGGCCTGGG - Intronic
1102018958 12:109668430-109668452 AGAACTCTGGAGGCTGGGCATGG - Intergenic
1106364264 13:29062274-29062296 AGCATTCTTGAGGCTGGGCATGG - Intronic
1107148985 13:37090644-37090666 TGCAAAATGGAGGCTGTAAAAGG - Intergenic
1108799830 13:54081814-54081836 TTCTTTCTGGATGCTGGACAAGG + Intergenic
1110390586 13:74968823-74968845 TGCAATAGGGAGGCTGGAAATGG - Intergenic
1111881725 13:93965735-93965757 TGTCATCTGGTGGCTTGACAAGG - Intronic
1113367088 13:109686413-109686435 TGTACTCTGGAGGCTGAACCTGG - Intergenic
1113850863 13:113417228-113417250 CCCAATCTGCAGGCTGGTCATGG + Intergenic
1114449251 14:22814078-22814100 TTCAAGTTGGAGGCTGGGCAAGG - Intronic
1115152185 14:30298325-30298347 TGCAATTTGTACTCTGGACAAGG - Intergenic
1118790083 14:69082958-69082980 TGTAATCTGGTGACAGGACATGG - Intronic
1118875206 14:69778622-69778644 TGGAATCTAGACCCTGGACAGGG + Intronic
1119776402 14:77251816-77251838 GGCAATGAGGAGGGTGGACAGGG - Exonic
1119787427 14:77324007-77324029 TGGCATCTGGAGTCTGGACCTGG - Intronic
1120649314 14:87112484-87112506 TGGAATCTAGAAGCTGGAAAAGG - Intergenic
1121266618 14:92607351-92607373 TGAAAAGTAGAGGCTGGACATGG + Intronic
1122031471 14:98915555-98915577 TGCAGTCTGGGGGCTGGGGAGGG - Intergenic
1124417049 15:29480855-29480877 GGCAATGTGGAGGCGAGACAAGG + Intronic
1126740651 15:51773168-51773190 TGCCTTCTGGAGGATAGACATGG + Intronic
1127940948 15:63695325-63695347 TTAAATTTGGAGGCTGGGCATGG - Intronic
1129676956 15:77636904-77636926 TGCACTGTGGAGGCCAGACAGGG + Intronic
1130824404 15:87529519-87529541 GTCAATCTGAAGGCTGGGCATGG + Intergenic
1131448802 15:92521708-92521730 TGCAACCTGGTGTCTGGCCATGG - Intergenic
1131726526 15:95231751-95231773 TGGAATCTGGGAGCTGGAGAAGG + Intergenic
1132298262 15:100760451-100760473 TGCAAGCTGCATACTGGACAAGG + Intergenic
1132323684 15:100947245-100947267 TGAAAACTGGAGCCTGGGCATGG - Intronic
1132502645 16:291415-291437 TGCAAACTGGAGCCTGCGCAGGG - Intronic
1133035718 16:3033012-3033034 TGGAAGCTGGGGGCTGGGCACGG + Intronic
1133271736 16:4613864-4613886 TGCAATGGGGAGGGTGCACACGG - Intronic
1133772497 16:8875459-8875481 TAGAATCAGGAGGCTGGGCACGG - Intergenic
1135023356 16:18980827-18980849 AGCAAGGTGGAGGCTGGGCATGG - Intergenic
1137730114 16:50683326-50683348 TGCAAACTGCAGGATGGAAAAGG - Intergenic
1137828731 16:51523844-51523866 TGCTATCTGCAGGCAGGTCATGG + Intergenic
1137864300 16:51877279-51877301 TGTTATCTGGAGTCTGGAAAAGG + Intergenic
1139626279 16:68191556-68191578 TGCATTCTGGTGGCTGGAGACGG - Exonic
1139924665 16:70479512-70479534 GGCCTTCTGGAGGCTGGACTGGG - Intronic
1140037218 16:71380596-71380618 TGAAATCCTGAGGCTGGGCATGG - Intronic
1140461768 16:75145823-75145845 TCCTTTCTGGATGCTGGACAAGG + Intergenic
1140504509 16:75463227-75463249 TGCAATCTGGAGGCACTACTGGG - Intronic
1141621948 16:85241001-85241023 TCCAGTCTGGAGGCTGGAGGAGG + Intergenic
1203140376 16_KI270728v1_random:1761112-1761134 TGCAAACTGGAGGCTGGGCAAGG + Intergenic
1142912033 17:3102632-3102654 TGAAATCTGGAGGCAGAACGGGG - Intergenic
1143170713 17:4928447-4928469 ACCCATCTGGAGGCTGGGCACGG - Intergenic
1143398867 17:6627462-6627484 TGCAATCTGAAAGCTGGGCTTGG + Intronic
1143409825 17:6702164-6702186 TGCAGACAGGAGCCTGGACAGGG - Intronic
1143621423 17:8082714-8082736 TGCAAAATGGAGGCTGCAAAAGG - Intronic
1143967760 17:10769020-10769042 AGAAATCTGCAGACTGGACAGGG - Intergenic
1145198462 17:20917403-20917425 TGCAATACATAGGCTGGACAGGG + Intergenic
1146199747 17:30846689-30846711 TTCAAACTGTTGGCTGGACACGG - Intronic
1146518694 17:33509534-33509556 TGCTAACTGGAGCCTGGGCAAGG - Intronic
1146726979 17:35164367-35164389 AGCCATCTGGAGGCTTGACTGGG + Intronic
1147196418 17:38769813-38769835 CCCAATCAGGAGGCTGCACATGG + Intronic
1147604392 17:41765963-41765985 TGCTATCTGTAGGCTGGGTATGG + Intronic
1149783943 17:59420040-59420062 AGCATTCTGGAGACTGGGCATGG - Intergenic
1151603407 17:75120522-75120544 TGCAGTATGGTGGCTGGGCACGG + Intronic
1152423599 17:80207091-80207113 TGCACGCTGGGGGCTGGGCAGGG + Intronic
1152664604 17:81560023-81560045 TCAAAACTGGAGGCTGGGCATGG - Intronic
1154311475 18:13270070-13270092 AGAAATGTGGAGGCTGGGCATGG + Intronic
1155005783 18:21727925-21727947 TGCAATCAAGGGGATGGACATGG - Intronic
1157690199 18:49675444-49675466 TGCAATGTGGAACCTGGACTGGG + Intergenic
1160077995 18:75695785-75695807 TGCAATCAGGAGTCTAGAAATGG + Intergenic
1160834539 19:1118447-1118469 AGCAATGTGGATGCTGAACACGG + Intronic
1161860125 19:6791783-6791805 TGCTTTCTGGAGGGTGGTCAAGG + Intronic
1161895949 19:7080465-7080487 TGGAAGCTGGAGGGTGGAGAGGG - Intronic
1161946211 19:7438699-7438721 AGAAATCTGGCGGCCGGACACGG - Intronic
1162897662 19:13774961-13774983 TGAAATCTGGAGGCCGGCGAGGG + Intronic
1162906615 19:13827679-13827701 TCCAATCAGGAGGCTGTCCAGGG - Intronic
1163772048 19:19197186-19197208 TGCGAGCTGGTGGATGGACAGGG - Exonic
1164580821 19:29433846-29433868 TGCTTTGAGGAGGCTGGACAGGG - Intergenic
1165139677 19:33691150-33691172 TGCACTCGGGAAGCTGGGCAGGG - Intronic
1165362165 19:35343589-35343611 TAAAGTCTGGAGGCTGGGCATGG + Intronic
1166424751 19:42667667-42667689 TGCAAAATGGAGGCTGCAAAAGG + Intronic
1166959142 19:46487564-46487586 CGAGATCTGCAGGCTGGACATGG - Intronic
1202645165 1_KI270706v1_random:132611-132633 TTCTTTCTGGATGCTGGACAAGG + Intergenic
1202645267 1_KI270706v1_random:133333-133355 TTCTTTCTGGATGCTGGACAAGG + Intergenic
925301272 2:2814474-2814496 TGCATTATGGAAGCTCGACAAGG + Intergenic
925894817 2:8463094-8463116 TGCACTCGGGAGGCTGGAGGAGG + Intergenic
926672013 2:15585534-15585556 AGTAAGCAGGAGGCTGGACATGG + Intergenic
926955905 2:18299530-18299552 TTCAATGTGTAGGCTGGACATGG - Intronic
927767807 2:25828855-25828877 TGCACTCAGGAGATTGGACAAGG - Intronic
928025066 2:27732875-27732897 TTCCATCTAGAGGCTGGTCATGG - Intergenic
928176342 2:29036794-29036816 TCCAAGCAGGAGGGTGGACATGG - Intronic
929208541 2:39326630-39326652 TGCAATTTGGGGGGTGGGCAGGG + Intronic
929446766 2:42008337-42008359 GGCAATCAGGAGGCTCTACAGGG + Intergenic
930010992 2:46938721-46938743 AGCACTTTGGAGGCTGGGCAGGG + Intronic
930237596 2:48902924-48902946 TGCAATCTTGAGGGTGGAGCAGG - Intergenic
930786099 2:55272953-55272975 TACAATATGGAGGCCGGGCACGG + Intergenic
931105108 2:59046750-59046772 TGCAGTCAGGAGGCAGGAAAAGG + Intergenic
932652097 2:73569303-73569325 AGCAAGCTGAAGGCTGGGCACGG - Intronic
932789026 2:74636867-74636889 TGAAATCTTGAGGCTGGGCATGG - Intronic
932892218 2:75607078-75607100 TGCAAACAGGAGCCTGGATAGGG + Intergenic
933161037 2:79025660-79025682 GGCAATATGTAGGCGGGACAGGG - Intergenic
933241085 2:79920974-79920996 AGCATTCTGCAGGCTGGACTGGG + Intronic
933835941 2:86245622-86245644 TGCAAAATGGAGGCTGCAAAAGG - Intronic
934507673 2:94906921-94906943 TTCTTTCTGGATGCTGGACAAGG + Intergenic
935179214 2:100675210-100675232 TGGCATATGGAGCCTGGACAGGG - Intergenic
936461334 2:112715593-112715615 AGCAATAAGGAGGCTGGAAAAGG + Intergenic
937075675 2:119104598-119104620 TGCCCTCTGGAGGAAGGACAGGG - Intergenic
937153975 2:119705330-119705352 TCTCATCTGGAGGCTGGACTGGG + Intergenic
942190480 2:173464382-173464404 TGCAATTTGGGGGCTGGGCGTGG - Intergenic
943081144 2:183260649-183260671 TGCAAACTGCTGGGTGGACACGG - Intergenic
944118710 2:196216860-196216882 TGCAATCAGGAGTCTGGAAATGG + Intronic
946926646 2:224633090-224633112 TGCAGGCTGGAGGGTGGAGAAGG + Intergenic
948273528 2:236691615-236691637 TGGCTTCTGGAAGCTGGACAAGG + Intergenic
948822356 2:240556615-240556637 TGCAAAATGGAGGCTGCAAAGGG - Intronic
948866197 2:240776017-240776039 TCAAAGCTGGAGGCTGGGCAAGG + Intronic
1168828038 20:827159-827181 TGTCATCTGAAGGCTGGACAAGG - Intergenic
1169437228 20:5603390-5603412 TGGAATCTGGAGGCTGGCAGTGG + Intronic
1169927185 20:10795350-10795372 TGCAAACTGCAAGCTGGAGAGGG - Intergenic
1171230783 20:23482499-23482521 TGCAACCAGGAGGCTGGAAGAGG - Intergenic
1171328654 20:24318250-24318272 AGCATTCTGGAGTCTGGGCATGG + Intergenic
1171895127 20:30751530-30751552 TTCTTTCTGGATGCTGGACAAGG + Intergenic
1171895229 20:30752253-30752275 TTCTTTCTGGATGCTGGACAAGG + Intergenic
1172187696 20:33041576-33041598 TGCCTCCTGGAGGCTGTACAGGG + Intronic
1172683425 20:36735080-36735102 TGACAGCTGGAGGCTGGTCATGG + Intronic
1173862862 20:46295644-46295666 TGGATTCTGGAAGCTGGACTTGG - Intronic
1174347716 20:49943204-49943226 TTCACTCTTGAGGCTGGGCATGG + Intronic
1174657762 20:52185869-52185891 TGCAAAGTGGAGCCTGGACACGG - Intronic
1175130837 20:56788481-56788503 TGCAATGATGGGGCTGGACAAGG + Intergenic
1175765690 20:61590965-61590987 TGCCATCTGGATGCTGTTCATGG - Intronic
1176606619 21:8839409-8839431 TTCTTTCTGGATGCTGGACAAGG - Intergenic
1176606726 21:8840132-8840154 TTCTTTCTGGATGCTGGACAAGG - Intergenic
1178046120 21:28696426-28696448 TGCAACCTGGATGCGAGACATGG - Intergenic
1179393179 21:41012287-41012309 TGGGATCTGGAGCCTGGACCTGG - Intergenic
1179422772 21:41249566-41249588 TGGAATCTGCCGGCTGGACATGG - Intronic
1179820653 21:43935071-43935093 ACCAGTGTGGAGGCTGGACAGGG + Intronic
1180356692 22:11849111-11849133 TTCTTTCTGGATGCTGGACAAGG - Intergenic
1180356795 22:11849833-11849855 TTCTTTCTGGATGCTGGACAAGG - Intergenic
1180381465 22:12142498-12142520 TTCTTTCTGGATGCTGGACAAGG + Intergenic
1180381569 22:12143220-12143242 TTCTTTCTGGATGCTGGACAAGG + Intergenic
1180783438 22:18534452-18534474 GGCACTGTGGAGGCTGGGCACGG - Intergenic
1181127004 22:20708501-20708523 GGCACTGTGGAGGCTGGGCACGG - Intronic
1181240338 22:21473804-21473826 GGCACTGTGGAGGCTGGGCACGG - Intergenic
1182086035 22:27561782-27561804 TGCCATCTGCAAGCTGGAGATGG - Intergenic
1182309068 22:29391901-29391923 TGCAAACTGTAGGCTGAGCAAGG - Intronic
1182902510 22:33910049-33910071 TGCACTGTGGTGGCTGAACACGG - Intronic
1183052530 22:35275408-35275430 TGAAATTTGGTGGCTGGGCATGG - Intronic
1183162643 22:36125180-36125202 TGCTCACTGGAGGCTGGAGAAGG + Intergenic
1183399944 22:37597156-37597178 TATAATCTGGAGGCTGGGCGCGG + Intergenic
1183630264 22:39028323-39028345 TGCGATGCAGAGGCTGGACAGGG + Intronic
1184565073 22:45286993-45287015 TGCAATGTGGGAGATGGACAAGG - Intronic
1184575973 22:45366312-45366334 ATCCAACTGGAGGCTGGACATGG - Intronic
949830237 3:8206789-8206811 TGCAAGCTGGAGACTGGAATAGG + Intergenic
950589955 3:13929924-13929946 TGACATATGGAGGCTGGGCAGGG - Intergenic
950958150 3:17077146-17077168 TGCAAGCAGTAAGCTGGACACGG + Intronic
952005556 3:28838564-28838586 TGCAATGTGGAGGGTCTACAGGG + Intergenic
952328357 3:32341150-32341172 TGCCATCTTCAGGCTGAACAGGG - Intronic
952813400 3:37425074-37425096 TTTAAAATGGAGGCTGGACACGG - Intronic
953287858 3:41630260-41630282 TCCAGTCTGGAGGCTGGAGGTGG + Intronic
953930167 3:47002004-47002026 TCCAAGCTGGAGGCTGCACTGGG + Exonic
954872655 3:53779526-53779548 TGCCATCTGCAAGCTGGACCTGG + Intronic
955132228 3:56181944-56181966 TGCAATCAGGCTGTTGGACAGGG - Intronic
955419774 3:58724702-58724724 TGCAAAATGGAGGCTGCAAAAGG - Intronic
956767011 3:72492383-72492405 TGGAATCTGGTTGCTGGCCAGGG + Intergenic
957180843 3:76875559-76875581 TGACCTCTGGAGGCTGGAAAAGG - Intronic
957487522 3:80882237-80882259 TGCTATAAAGAGGCTGGACACGG + Intergenic
959518674 3:107301001-107301023 TGCAATCTGTAAATTGGACAGGG - Intergenic
960899418 3:122539852-122539874 TGCCATCTCGGGGCTGGGCACGG - Intronic
960962264 3:123080316-123080338 GGCTACCTGGAGGCTGGAGACGG + Intronic
963102855 3:141622827-141622849 TGCTTCCTGGATGCTGGACAAGG + Intergenic
964475797 3:157096585-157096607 TGCAATCTGGAGTCTGTGCTAGG + Intergenic
964631162 3:158812242-158812264 GTCATTCTGGAGGCTGCACAGGG + Intronic
964666420 3:159179186-159179208 TGCAGTTTGGATGCTAGACATGG + Intronic
967878808 3:194284640-194284662 TGGGGTCTGGCGGCTGGACATGG + Intergenic
968635714 4:1677706-1677728 TGCCATCTGAAGGGAGGACACGG - Intronic
968870836 4:3241376-3241398 TGCAAACAGGAGGCTGGTCCAGG - Exonic
969331720 4:6477434-6477456 TTAAAACTGGAGGCTGGGCACGG + Intronic
969348752 4:6585738-6585760 TGTCATCTGAAGGCTGGACTGGG + Intronic
969489690 4:7491978-7492000 TGCCTCCTGGAGGCTGGGCAGGG + Intronic
969630134 4:8331045-8331067 TGCCAGCTGGCGGCTGGAGAAGG - Intergenic
971384387 4:26129749-26129771 TGCTGTCTGGAGGCTAGATAGGG - Intergenic
971449948 4:26790683-26790705 TGCATTCTGGAGGCAAGAGATGG + Intergenic
972061591 4:34881051-34881073 TGAATGATGGAGGCTGGACATGG + Intergenic
973371386 4:49251025-49251047 TTCTTTCTGGATGCTGGACAAGG + Intergenic
973371493 4:49251748-49251770 TTCTTTCTGGATGCTGGACAAGG + Intergenic
973389515 4:49543563-49543585 TTCTTTCTGGATGCTGGACAAGG - Intergenic
973389620 4:49544286-49544308 TTCTTTCTGGATGCTGGACAAGG - Intergenic
974077308 4:57179166-57179188 TTCAAATTGGAGGTTGGACATGG - Intergenic
975600796 4:76097495-76097517 TGCAAATTGCAGGCTGGGCATGG - Intronic
984791112 4:183615937-183615959 TGGAATATTGAGGCTGGGCACGG - Intergenic
985925607 5:3014195-3014217 TGGAATCTGGAGGATGGAGCAGG - Intergenic
987053580 5:14168981-14169003 TGCAATCTGGACTTTGCACATGG + Intronic
987062455 5:14255503-14255525 TGCAAACTGGAGGCAAGTCACGG + Intronic
987315658 5:16720746-16720768 TACAATGTGGAGGCTGGGCGCGG - Intronic
987580884 5:19790716-19790738 ATCAATCTGGATGCTGGATAAGG + Intronic
988173494 5:27690420-27690442 TGTCATCTGGAGGCTTGACTAGG - Intergenic
990001578 5:50899383-50899405 TGCAATGTGGAGGATGGGCTTGG + Intergenic
991506782 5:67333182-67333204 TTCAATAAGGAGGCTGGGCACGG - Intergenic
992339205 5:75805134-75805156 TGCAATCTAGAAGCTGGAAAGGG + Intergenic
992362021 5:76048791-76048813 CACAATCTGGAGGCTGAAAAAGG - Intergenic
992875288 5:81048366-81048388 TGCACTCTGTAGGCTGTAAAAGG - Intronic
993726133 5:91368359-91368381 TGAAATTTAGAGTCTGGACATGG + Intergenic
994066219 5:95545566-95545588 TGCAATCTGTAGGATGTATAGGG - Intronic
995240731 5:109883213-109883235 AGCATTCTGCTGGCTGGACATGG - Exonic
995775138 5:115717030-115717052 TGTCATCTAGAGGCTGGACTGGG + Intergenic
996795620 5:127343422-127343444 GTCATTCTGGAGGCTTGACATGG + Intronic
997457677 5:134029228-134029250 TGCAATCAAGAGGTTGGTCAGGG - Intergenic
999017219 5:148120074-148120096 TGCCATCTGGACCCCGGACAGGG - Exonic
999020388 5:148159125-148159147 TTTAAGTTGGAGGCTGGACAAGG - Intergenic
999138063 5:149336595-149336617 TGCAGTCTGGAGGCGGCCCAGGG + Intronic
1000196215 5:158960910-158960932 AGCAATCTGAAGGCTCGACCGGG - Intronic
1000341500 5:160280526-160280548 TGCAAGCAGGAGGCAGGAGACGG + Exonic
1001821307 5:174712540-174712562 AACAATCTTGAGGCTGGGCACGG - Intergenic
1001921965 5:175607828-175607850 TTCCATGTGGAGGCTGGGCACGG + Intergenic
1002993041 6:2255638-2255660 TCTCATCTGGAGGCTTGACAGGG + Intergenic
1003561363 6:7183541-7183563 TCTGATCTGGAGGCTGGACTTGG - Intronic
1005575758 6:27187936-27187958 TGCAAAATGGAGGCTGCAAAAGG - Intergenic
1005576654 6:27196144-27196166 TGCAAAATGGAGGCTGCAAAAGG - Intergenic
1005721656 6:28608321-28608343 TGCAAAATGGAGGCTGCAAAAGG - Intronic
1006150576 6:31984804-31984826 TGCAAAATGGAGGCTGCAAAAGG + Intronic
1006151130 6:31990617-31990639 TGCAAAATGGAGGCTGCAAAAGG + Intronic
1006156877 6:32017542-32017564 TGCAAAATGGAGGCTGCAAAAGG + Intronic
1006157431 6:32023355-32023377 TGCAAAATGGAGGCTGCAAAAGG + Intronic
1006223227 6:32513252-32513274 TGCAAACTGGAGGCTGCAAAAGG - Intergenic
1006459387 6:34149572-34149594 TGACCTCTGGAGGCAGGACAGGG - Intronic
1006902227 6:37510678-37510700 TGCAACCTGGAGCCTGGGCCTGG - Intergenic
1007620737 6:43212993-43213015 TGAGATCTGGAAGCTTGACAAGG + Intronic
1010242450 6:73629096-73629118 TGCTATCTTCAGGCTGGGCATGG + Intronic
1011166061 6:84447803-84447825 TAGAATCTGGGGGCTGCACATGG + Intergenic
1011559414 6:88599729-88599751 TGCACTCTGCTGGCTGGAAATGG - Intergenic
1011736540 6:90316174-90316196 TGCACTCGGGAGGATAGACAAGG - Intergenic
1011797021 6:90967567-90967589 TGTCATCTGAAGGCTTGACAGGG + Intergenic
1012043002 6:94234145-94234167 TTCTTTCTGGACGCTGGACAAGG + Intergenic
1012545965 6:100419929-100419951 ACCAAACTGGAGGCTGGGCACGG - Intronic
1013012758 6:106134865-106134887 TGAAAGCTGGAGGGTGGACTGGG - Intergenic
1013637687 6:112044690-112044712 GGCAATGTTGAGGCTGGACTGGG + Intergenic
1014682661 6:124451901-124451923 TCAAACCTGGAGGCTCGACATGG + Intronic
1016271923 6:142300454-142300476 TCTGATCTGAAGGCTGGACAGGG - Intergenic
1016797044 6:148129427-148129449 AGAAATCTGTAGGCTGGGCACGG + Intergenic
1018681994 6:166272060-166272082 TGCTAGCTGGAGGCTGCAAAGGG - Intergenic
1018745002 6:166754997-166755019 TGGAATCTGGAAGCTGGAAGGGG - Intronic
1021736197 7:23640205-23640227 TAAAATCTGGGGGCTGGGCATGG + Intronic
1023765618 7:43507962-43507984 TGAAGTCAGGATGCTGGACAGGG - Intronic
1023846931 7:44127149-44127171 AGCAATTTGAAGACTGGACAGGG - Intergenic
1025886662 7:65601159-65601181 TGCAGTCTGGATGCTAAACAGGG + Intergenic
1026300485 7:69093434-69093456 TTATATCTGGAGGCTGGTCACGG - Intergenic
1027782333 7:82534926-82534948 TTTCATCTGGAGGCTTGACATGG - Intergenic
1028089040 7:86674197-86674219 TGTCATCTGGAGGCTTGACCAGG + Intronic
1028993173 7:97072388-97072410 TTCCATCTTGAGGCTGGGCATGG + Intergenic
1029123233 7:98281835-98281857 TACAACCTGGAGGCCGGCCAGGG + Exonic
1029880448 7:103803141-103803163 TGCAATCATTAAGCTGGACAGGG - Intronic
1030896746 7:115070426-115070448 TGAAATCTAGATGATGGACAAGG + Intergenic
1031855758 7:126920783-126920805 TGCAGTCTGGATGCTAAACAGGG - Intronic
1032345781 7:131115177-131115199 TGCAAGCTTAAGGCTGCACAAGG + Intronic
1033706104 7:143886209-143886231 AGGAATCTGGAGACAGGACAGGG - Intronic
1034713303 7:153216619-153216641 CTCACTCAGGAGGCTGGACAGGG - Intergenic
1035252090 7:157604175-157604197 TGGACCCTGGAGGCTGGGCAGGG - Intronic
1035605113 8:925447-925469 TTCTGTGTGGAGGCTGGACAGGG + Intergenic
1037945187 8:22985201-22985223 TGCAAAATGGAGGCTGCAAAAGG + Intronic
1039117510 8:34108638-34108660 GGCCACCTGGAGGCTCGACATGG - Intergenic
1039840262 8:41287948-41287970 TGCACTTTGTATGCTGGACATGG + Intronic
1039851106 8:41365972-41365994 TGCAATTTGGAGGCTGAGGATGG + Intergenic
1040536345 8:48314529-48314551 TGCAACATGGGGGCTGGGCACGG - Intergenic
1040663300 8:49600098-49600120 TACCATTTGCAGGCTGGACACGG + Intergenic
1041000364 8:53443448-53443470 TGTAAGCTGTAGGCAGGACATGG - Intergenic
1042409042 8:68441232-68441254 TCTCATCTGGAGGCTGGACTAGG + Intronic
1042504560 8:69545983-69546005 AACAGTGTGGAGGCTGGACATGG - Intronic
1042869674 8:73386904-73386926 TGGAAACTGGAGTCTGGAGAAGG + Intergenic
1043533665 8:81176644-81176666 TAGTATCTGGAGGCTGCACAAGG + Intergenic
1043790442 8:84460361-84460383 TGCAAAGTGAAGGCTGTACAGGG + Intronic
1047545410 8:125811645-125811667 TGAAATCTGGAGGTTAGAGAAGG - Intergenic
1049041623 8:140116272-140116294 AGCTATCTGGAAGCTGGACAGGG + Intronic
1049677573 8:143898712-143898734 AACAATATGGAGGCTGGGCATGG + Intergenic
1051158140 9:14173892-14173914 AGCACTGTGGAGGCTGGGCATGG + Intronic
1051714688 9:19970084-19970106 AGCAAGCTGCAGTCTGGACAAGG + Intergenic
1051958708 9:22731481-22731503 TGCAATCTGGTTGCTTGCCAAGG - Intergenic
1052836333 9:33252756-33252778 TCCCACCTGGGGGCTGGACAGGG + Exonic
1052850604 9:33376222-33376244 TGAAGTCTGGAGGCAGGACTGGG + Intergenic
1052863529 9:33451302-33451324 AGCAACCTGGAGGCCGGGCATGG + Intergenic
1052993995 9:34539928-34539950 TGCAAAATGGAGGCTGCAAAAGG + Intergenic
1054353423 9:64040514-64040536 TTCTTTCTGGATGCTGGACAAGG - Intergenic
1054353523 9:64041237-64041259 TTCTTTCTGGATGCTGGACAAGG - Intergenic
1056154463 9:83820305-83820327 TGCCAGCTGGACCCTGGACACGG + Intronic
1056356039 9:85802813-85802835 TGCCAGCTGGACCCTGGACACGG - Intergenic
1057267877 9:93630875-93630897 CAGAATCTGCAGGCTGGACATGG + Intronic
1057433632 9:95019303-95019325 TCCAATTTGGAGACGGGACAAGG - Intronic
1058007531 9:99934100-99934122 TGCTATCTGGATGCTGGATAAGG + Intronic
1059355955 9:113699594-113699616 TGCTATCTGGAGAATGGCCAAGG + Intergenic
1059363729 9:113769065-113769087 TGCATGCTGGAGGATGGGCACGG + Intergenic
1059364571 9:113776145-113776167 TGCCATCTGGAAGCTGGACTTGG - Intergenic
1060819427 9:126652741-126652763 TTCACTCTGGAGACAGGACATGG - Intronic
1061169118 9:128941778-128941800 TGCAACCAGGAGGCTGAGCAAGG - Exonic
1061194742 9:129101702-129101724 TGCAAAATGGAGGCTGCAAAAGG - Intronic
1061372129 9:130203393-130203415 TTCACACTGGAGGCTGGGCACGG - Intronic
1061513914 9:131077384-131077406 TAGAAGCTGGAGGCTGGGCACGG + Intronic
1061597676 9:131642686-131642708 AGCAGCCTGGAGGCTGCACAGGG - Intronic
1203695930 Un_GL000214v1:96816-96838 TTCTTTCTGGATGCTGGACAAGG + Intergenic
1203741754 Un_GL000218v1:9624-9646 TTCTTTCTGGATGCTGGACAAGG - Intergenic
1203741859 Un_GL000218v1:10346-10368 TTCTTTCTGGATGCTGGACAAGG - Intergenic
1203701943 Un_KI270742v1:4214-4236 TTCTTTCTGGATGCTGGACAAGG - Intergenic
1203702050 Un_KI270742v1:4937-4959 TTCTTTCTGGATGCTGGACAAGG - Intergenic
1203553927 Un_KI270743v1:190269-190291 TTCTTTCTGGATGCTGGACAAGG - Intergenic
1203554030 Un_KI270743v1:190992-191014 TTCTTTCTGGATGCTGGACAAGG - Intergenic
1203640343 Un_KI270751v1:7247-7269 TTCTTTCTGGATGCTGGACAAGG - Intergenic
1189610186 X:42724260-42724282 TGCCATCAGGAGGCAGGAAAAGG - Intergenic
1190556040 X:51636929-51636951 TGCAAAATGGAGGCTGCAAAAGG - Intergenic
1195065772 X:101236952-101236974 AGGAAGCTGGAGGCTGGCCAAGG - Intronic
1195295236 X:103469984-103470006 TGCAAAATGGAGGCTGCAAAAGG + Intergenic
1197804391 X:130385199-130385221 TGCCATCCGCAGGCTGCACAGGG + Exonic
1200010293 X:153115282-153115304 TGCAAAGTGGAGGCTGAACTAGG + Intergenic
1200029307 X:153284640-153284662 TGCAAAGTGGAGGCTGAACTAGG - Intergenic
1200140094 X:153896494-153896516 TGAAGTCTGGATGCAGGACAAGG + Intronic
1201155286 Y:11127078-11127100 TTCCTTCTGGATGCTGGACAAGG - Intergenic
1201347490 Y:13000648-13000670 TGCAAAATGGAGGCTGCAAAAGG + Intergenic