ID: 1074524294

View in Genome Browser
Species Human (GRCh38)
Location 10:114250872-114250894
Sequence TTGCAATCTGGAGGCTGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 250}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074524294_1074524303 26 Left 1074524294 10:114250872-114250894 CCTGTCCAGCCTCCAGATTGCAA 0: 1
1: 0
2: 0
3: 14
4: 250
Right 1074524303 10:114250921-114250943 TGGGTTATACAGATGAGGCAGGG No data
1074524294_1074524298 6 Left 1074524294 10:114250872-114250894 CCTGTCCAGCCTCCAGATTGCAA 0: 1
1: 0
2: 0
3: 14
4: 250
Right 1074524298 10:114250901-114250923 GCACTTGTTCTGATCATCCTTGG No data
1074524294_1074524304 27 Left 1074524294 10:114250872-114250894 CCTGTCCAGCCTCCAGATTGCAA 0: 1
1: 0
2: 0
3: 14
4: 250
Right 1074524304 10:114250922-114250944 GGGTTATACAGATGAGGCAGGGG No data
1074524294_1074524305 30 Left 1074524294 10:114250872-114250894 CCTGTCCAGCCTCCAGATTGCAA 0: 1
1: 0
2: 0
3: 14
4: 250
Right 1074524305 10:114250925-114250947 TTATACAGATGAGGCAGGGGAGG No data
1074524294_1074524300 21 Left 1074524294 10:114250872-114250894 CCTGTCCAGCCTCCAGATTGCAA 0: 1
1: 0
2: 0
3: 14
4: 250
Right 1074524300 10:114250916-114250938 ATCCTTGGGTTATACAGATGAGG No data
1074524294_1074524302 25 Left 1074524294 10:114250872-114250894 CCTGTCCAGCCTCCAGATTGCAA 0: 1
1: 0
2: 0
3: 14
4: 250
Right 1074524302 10:114250920-114250942 TTGGGTTATACAGATGAGGCAGG No data
1074524294_1074524299 7 Left 1074524294 10:114250872-114250894 CCTGTCCAGCCTCCAGATTGCAA 0: 1
1: 0
2: 0
3: 14
4: 250
Right 1074524299 10:114250902-114250924 CACTTGTTCTGATCATCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074524294 Original CRISPR TTGCAATCTGGAGGCTGGAC AGG (reversed) Intronic
900724289 1:4205143-4205165 TTTCCATCTGGAGGTTCGACTGG - Intergenic
902645873 1:17797612-17797634 CTGCATTCTGAAGGCAGGACAGG - Intronic
902667681 1:17951048-17951070 TTGACATCTGGAGGCAGGACTGG + Intergenic
903097867 1:20996484-20996506 TTCCAATCTGGAGGATGTAAAGG - Intronic
906070559 1:43013438-43013460 TAGCCATTTGGAGGATGGACTGG + Intergenic
907498194 1:54859250-54859272 TAGTCATCTGGAGGCTTGACTGG - Intronic
907652774 1:56311557-56311579 CTGCAATATAGAGGATGGACTGG - Intergenic
912387240 1:109277607-109277629 TTGCCACCTGGCGGCTGGAGAGG - Intergenic
916295146 1:163210933-163210955 TTGGAATCTGGAGAATGGAGTGG + Intronic
917927891 1:179804085-179804107 TTTCAATCTGGAGGCAGCAGGGG - Intronic
918249475 1:182688892-182688914 TTCCCTTCTGGAGGCTGGAGGGG - Intergenic
918555384 1:185793268-185793290 TTACCATCTGGAGGCTGGAGGGG + Intronic
920395141 1:205639700-205639722 TGGCAATGTGGAGGATGGGCTGG - Intergenic
920447847 1:206033401-206033423 TTCCTTTCTGGAGGCTGGAGGGG + Intergenic
920452927 1:206073828-206073850 TTGCAATGTGGAGAATAGACTGG - Intronic
920818554 1:209358352-209358374 TTGCATTCTGGAGGCTCTAGGGG + Intergenic
921668950 1:217905514-217905536 TTCCTTTCTGGAGGCTGGAGGGG - Intergenic
923435678 1:233965691-233965713 TTCTCATCTGGAGGCTGGAGTGG - Intronic
924154989 1:241166684-241166706 TTGCAATCTGAAGACTGGCAGGG - Intronic
924623780 1:245684338-245684360 ATGCAATCTGGATGGTGGACAGG - Exonic
1063798354 10:9539613-9539635 TATCAATCTGTAGACTGGACTGG - Intergenic
1064583895 10:16820215-16820237 TAGCAATCAGGACCCTGGACAGG - Intergenic
1064720312 10:18222152-18222174 TTTCAATCTAGAGGTTGGATCGG - Intronic
1067121537 10:43476135-43476157 TTGCAAGTTGGAGCATGGACAGG + Exonic
1067200968 10:44171850-44171872 CTGCAATGTGGTGGGTGGACAGG + Intergenic
1067321732 10:45227249-45227271 TAGCAATCAGGACCCTGGACAGG - Intergenic
1067524795 10:47031802-47031824 TTGCAATCTGAAAGCTCTACAGG - Intergenic
1067696846 10:48541963-48541985 TTGCTATCAGCAGGTTGGACAGG + Intronic
1069591062 10:69642183-69642205 TTCTCATCTGGAGGCTCGACTGG + Intergenic
1070324840 10:75381697-75381719 TTGAAATCTGGAGGCAGCCCAGG - Intergenic
1070417278 10:76202754-76202776 GTGCAATCTGGAGGAAGGAGCGG + Intronic
1070432429 10:76354270-76354292 TTGTGATATGGAGGCTGAACAGG + Intronic
1071185108 10:83034386-83034408 TTCTCATCTGGAGGCTTGACTGG + Intergenic
1072221435 10:93330786-93330808 TTGCACTCTGGTGTGTGGACTGG + Intronic
1073378951 10:103063199-103063221 TTTCAATCTGGAGTCTGCAATGG - Intronic
1073724511 10:106214164-106214186 TTCTTATCTGGAGGCTGGATTGG - Intergenic
1074524294 10:114250872-114250894 TTGCAATCTGGAGGCTGGACAGG - Intronic
1076203170 10:128573861-128573883 ATGCAAACTGGAGCCTGGTCTGG + Intergenic
1076274078 10:129181883-129181905 TTGCTCTCTGGAGAATGGACAGG - Intergenic
1077025813 11:439395-439417 CCCCAACCTGGAGGCTGGACTGG - Intronic
1077201901 11:1312034-1312056 TTCTCATCTGGAGGCTTGACTGG - Intergenic
1077595162 11:3525677-3525699 TTCTCATCTGGAGGCTTGACTGG - Intergenic
1078479237 11:11661629-11661651 TTCCAGTCTGGAGAATGGACTGG - Intergenic
1078527822 11:12113498-12113520 CTGCACTCTGGAGGCTTGGCAGG + Intronic
1079700029 11:23534643-23534665 TTGGAATCTAAAGGCTTGACGGG - Intergenic
1079915483 11:26364494-26364516 TTGCCATCTGCAGGCTTTACAGG + Intronic
1080442714 11:32310176-32310198 GTGCTTTCTGGAGGCTGGAGAGG - Intergenic
1080508068 11:32937615-32937637 TGACAATGTGGAGGATGGACTGG - Intronic
1083225630 11:61282728-61282750 TGCCAATCAGGAGGATGGACAGG - Intronic
1083465613 11:62843751-62843773 TTGCTTTCTGGAGGCTGCATGGG - Intergenic
1084251066 11:67899656-67899678 TTCTCATCTGGAGGCTTGACTGG - Intergenic
1084666278 11:70578020-70578042 TCACATTCTGGAGGCTGGAATGG - Intronic
1084714035 11:70862460-70862482 TTGGTATTTGGAGCCTGGACTGG + Intronic
1084821774 11:71696391-71696413 TTCTCATCTGGAGGCTTGACTGG + Intergenic
1085468042 11:76737489-76737511 TCGCAATCTGCAGGCTTGATGGG + Intergenic
1086081070 11:82902441-82902463 CAGCAATGTGGAGACTGGACTGG - Intronic
1086217740 11:84404040-84404062 TTGAAATTTGGAGACTGGATTGG - Intronic
1087238752 11:95751523-95751545 TGGCATTCTGGAAGCAGGACAGG + Intergenic
1089300827 11:117497725-117497747 CTGCCACCTGGAGGCTGGGCAGG + Intronic
1092421328 12:8334450-8334472 TTCTCATCTGGAGGCTTGACTGG - Intergenic
1092570835 12:9719622-9719644 TGGCCTTCTGGAGGCTGGAGGGG + Intronic
1097217037 12:57422228-57422250 TAGCAATTTGGAGACTGGATTGG - Intronic
1098021107 12:66157370-66157392 TGGTCATCTGGAGGCTTGACTGG - Intronic
1098113328 12:67147522-67147544 TTCTCATCTGGAGGCTTGACTGG + Intergenic
1100331625 12:93587974-93587996 TGGCAATATGGAGGCTGCTCTGG + Intergenic
1101139387 12:101779476-101779498 GTGGACTCTGGAGGCTGGCCTGG - Intronic
1103066232 12:117900006-117900028 TTCTCATCTGAAGGCTGGACTGG - Intronic
1103898351 12:124289483-124289505 TGGGAATCTGGAGGCTGTCCTGG + Intronic
1106416556 13:29550678-29550700 TTTTCATCTGGAGGCTTGACTGG - Intronic
1106730064 13:32532081-32532103 TTGCAATGGGGAGGCTGTCCTGG - Intronic
1107029403 13:35835242-35835264 TGGCTTTCTGGGGGCTGGACTGG - Intronic
1107373621 13:39778731-39778753 TTGTCATCTGAAGGCTTGACTGG + Intronic
1109929719 13:69198872-69198894 TTCCTATCTGGAGGCTTGACTGG - Intergenic
1119776403 14:77251817-77251839 TGGCAATGAGGAGGGTGGACAGG - Exonic
1120133426 14:80835035-80835057 TTGCTCTCCTGAGGCTGGACTGG + Intronic
1120791032 14:88582295-88582317 TTGCAAACTGACTGCTGGACTGG - Intronic
1121040631 14:90743876-90743898 TTGGAGGCTGGAGGCTGGATGGG - Intronic
1122031472 14:98915556-98915578 TTGCAGTCTGGGGGCTGGGGAGG - Intergenic
1125593802 15:40872081-40872103 TTGAAAGGTGGGGGCTGGACTGG - Intergenic
1125738441 15:41944500-41944522 GTGCACTGTGGAGGCTGGCCAGG - Intronic
1126896956 15:53268384-53268406 ATGCCATCTGGAAGCTGGAGAGG + Intergenic
1130299966 15:82672991-82673013 TTTTTATCTGGAGGCTGTACTGG - Intronic
1132057159 15:98661045-98661067 TTGAGATCTGAAGGCTGGAAGGG - Intronic
1133377017 16:5295491-5295513 TTCTCATCTGGAGGCTTGACGGG + Intergenic
1133803898 16:9108281-9108303 TTGCATTTTGGAGACAGGACTGG - Intronic
1134075889 16:11291044-11291066 TTACAATCAGGAGACTGGCCAGG + Intronic
1134165755 16:11927986-11928008 TTGAAACCTGGAGGATGGAAAGG - Intronic
1134500352 16:14764874-14764896 TTGAAACCTGGAGGATGGAAAGG + Intronic
1134526893 16:14951486-14951508 TTGAAACCTGGAGGATGGAAAGG + Intronic
1134545511 16:15104865-15104887 TTGAAACCTGGAGGATGGAAAGG - Intronic
1134580227 16:15364176-15364198 TTGAAACCTGGAGGATGGAAAGG - Intronic
1134714470 16:16349963-16349985 TTGAAACCTGGAGGATGGAAAGG + Intergenic
1134722345 16:16393327-16393349 TTGAAACCTGGAGGATGGAAAGG + Intronic
1134859448 16:17548024-17548046 TTGGAATATGGAAGATGGACTGG + Intergenic
1134880969 16:17745287-17745309 TTGTCATCTGGAGGCCTGACGGG + Intergenic
1134945082 16:18318542-18318564 TTGAAACCTGGAGGATGGAAAGG - Intronic
1134952346 16:18358695-18358717 TTGAAACCTGGAGGATGGAAAGG - Intergenic
1135234396 16:20741943-20741965 TTGCAGTCGGGAGGCGGGGCAGG - Exonic
1135311147 16:21405400-21405422 TTGAAACCTGGAGGATGGAAAGG - Intronic
1135364099 16:21837851-21837873 TTGAAACCTGGAGGATGGAAAGG - Intronic
1135447743 16:22533497-22533519 TTGAAACCTGGAGGATGGAAAGG + Intronic
1136150300 16:28343295-28343317 TTGAAACCTGGAGGATGGAAAGG - Intronic
1136166537 16:28457133-28457155 TTGAAACCTGGAGGATGGAAAGG - Intronic
1136196437 16:28657899-28657921 TTGAAACCTGGAGGATGGAAAGG + Intronic
1136212777 16:28772024-28772046 TTGAAACCTGGAGGATGGAAAGG + Intronic
1136257500 16:29051943-29051965 TTGAAACCTGGAGGATGGAAAGG + Intronic
1136307851 16:29384396-29384418 TTGAAACCTGGAGGATGGAAAGG - Intronic
1136321267 16:29485940-29485962 TTGAAACCTGGAGGATGGAAAGG - Intronic
1136435947 16:30225910-30225932 TTGAAACCTGGAGGATGGAAAGG - Intronic
1137347411 16:47677441-47677463 TCACAATCTGCAGGCTGGAAAGG + Intronic
1137445352 16:48528218-48528240 TTCTCATCTGGAGGCTTGACTGG + Intergenic
1139855541 16:69976839-69976861 TTGAAACCTGGAGGATGGAAAGG - Intergenic
1139924666 16:70479513-70479535 AGGCCTTCTGGAGGCTGGACTGG - Intronic
1140367192 16:74391262-74391284 TTGAAACCTGGAGGATGGAAAGG + Intronic
1140504510 16:75463228-75463250 GTGCAATCTGGAGGCACTACTGG - Intronic
1141267226 16:82508152-82508174 TTCTCATCTGGAGGCTTGACTGG - Intergenic
1142912034 17:3102633-3102655 GTGAAATCTGGAGGCAGAACGGG - Intergenic
1143409826 17:6702165-6702187 TTGCAGACAGGAGCCTGGACAGG - Intronic
1144734388 17:17546755-17546777 TTGCAATTTGGAAGCAGGCCAGG + Intronic
1145198461 17:20917402-20917424 TTGCAATACATAGGCTGGACAGG + Intergenic
1146233491 17:31134634-31134656 TAGTAATCTGAAGGCTTGACTGG + Intronic
1146726978 17:35164366-35164388 CAGCCATCTGGAGGCTTGACTGG + Intronic
1150779365 17:68107717-68107739 GAGCAATATGGAGGATGGACTGG + Intergenic
1154117012 18:11620027-11620049 TTGAAACCTGGAGGATGGAAAGG - Intergenic
1155474917 18:26227563-26227585 TTTCCATGTGGAGGATGGACCGG + Intronic
1157690198 18:49675443-49675465 GTGCAATGTGGAACCTGGACTGG + Intergenic
1159195246 18:65105085-65105107 TTGCTATCTGAAGACTGGAGAGG - Intergenic
1159707808 18:71715257-71715279 TTACACTCTGGAGACTGGATTGG - Intergenic
1160235674 18:77084501-77084523 GTGCCAGCTGGAGGCCGGACAGG - Intronic
1160990645 19:1859022-1859044 CTGCACTCTGCAGGCTGGAGAGG + Intronic
1161000888 19:1910214-1910236 TTGTCATCTGGAGGCTCAACGGG + Intronic
1161347406 19:3775194-3775216 TTGAAAGGTGGAGGCTGGAAAGG - Intergenic
1163560605 19:18017203-18017225 TGGCAGGCTGGAGGCTGGAATGG + Intergenic
1164597736 19:29541250-29541272 TTGCAATGTGGAGATTGGAGAGG + Intronic
1165188668 19:34043661-34043683 TTCTAATCTGGAGGCTCAACTGG - Intergenic
925020033 2:561647-561669 TTGTTATCAGGAGGCTGCACAGG - Intergenic
925292946 2:2760666-2760688 TTCTCATCTGGAGGCTTGACTGG + Intergenic
926248738 2:11140938-11140960 TGGCAATGTGGAGGATGGATTGG - Intronic
927436957 2:23074902-23074924 TTGCAATTTGGGGGCTGCTCTGG - Intergenic
927755966 2:25708122-25708144 GTGCAAGCAGCAGGCTGGACAGG + Intergenic
929648943 2:43658538-43658560 TAGTAATCTGAAGGCTTGACTGG + Intronic
930479027 2:51923967-51923989 TAGTCATCTGAAGGCTGGACTGG - Intergenic
933241084 2:79920973-79920995 CAGCATTCTGCAGGCTGGACTGG + Intronic
934737908 2:96699226-96699248 TGGGAACTTGGAGGCTGGACAGG - Intergenic
936012324 2:108932941-108932963 TTGTACTCGGGAGGCAGGACAGG - Intronic
937153974 2:119705329-119705351 TTCTCATCTGGAGGCTGGACTGG + Intergenic
937516977 2:122666231-122666253 TTGCAACGTTCAGGCTGGACAGG + Intergenic
937956855 2:127426568-127426590 TTCCCATGTGGAGGCTGGAGGGG - Intronic
940256798 2:151739446-151739468 TTCTCATCTGCAGGCTGGACTGG - Intergenic
940732693 2:157412113-157412135 TTGTTATCTGGAGGCTTGATTGG - Intergenic
946805258 2:223464839-223464861 TTGCATTCTGGAGGCTCTAGGGG + Intergenic
948709341 2:239815930-239815952 TTGCATTCTCGAGGGGGGACTGG + Intergenic
948709427 2:239816547-239816569 TTGCATTCTCGAGGGAGGACTGG + Intergenic
948822357 2:240556616-240556638 TTGCAAAATGGAGGCTGCAAAGG - Intronic
1170056381 20:12209204-12209226 TAGAAGTCTAGAGGCTGGACAGG - Intergenic
1170777574 20:19390976-19390998 TTGGGCTCTGGAGGCTGGCCTGG + Intronic
1173808255 20:45940308-45940330 TTGCAAGTTGCAGGCAGGACTGG + Intronic
1176158674 20:63637183-63637205 TGGCCATCTGAAGGCTGGGCAGG - Intergenic
1176268775 20:64224444-64224466 TTCCCCTCTGGAGGCTGGTCTGG + Intronic
1178573765 21:33765975-33765997 ATGTATTCTGGAGGCAGGACAGG - Exonic
1180089372 21:45525945-45525967 ATGCAATCTGAAAGCTGAACGGG + Exonic
1180968330 22:19802016-19802038 TGGCTGTCTGGAGCCTGGACTGG - Exonic
1181036181 22:20170774-20170796 TTGCAGCCTGGAGCCTGGTCTGG + Intergenic
1181081418 22:20418297-20418319 CTGCCATCTGGCGGCTGGATGGG - Intergenic
1183814733 22:40290189-40290211 TTGAAATGTGGCCGCTGGACTGG + Intronic
1184361514 22:44021929-44021951 TTTCCATTTGGAGGCTGCACGGG - Intronic
1184607251 22:45581271-45581293 TGGTGATCTGGAGGCTGGAGGGG - Intronic
1184772884 22:46608198-46608220 CTGCAGGCTGCAGGCTGGACAGG - Intronic
950202811 3:11056899-11056921 CTGCAGTGTAGAGGCTGGACTGG - Intergenic
951218806 3:20048277-20048299 TTGCAATCTGAAGGCTTTGCAGG - Intronic
953720678 3:45352176-45352198 TAGCCATCTGAAGGCTTGACTGG + Intergenic
953720799 3:45353334-45353356 TAGCCATCTGAAGGCTTGACTGG + Intergenic
953908520 3:46880806-46880828 GTGCAGTCTGGAAGCTGGATGGG + Intronic
953930166 3:47002003-47002025 CTCCAAGCTGGAGGCTGCACTGG + Exonic
954623744 3:52010837-52010859 TTGCATTCTGGAGGCTCTAATGG - Intergenic
955132229 3:56181945-56181967 TTGCAATCAGGCTGTTGGACAGG - Intronic
955310738 3:57884296-57884318 TTGCTCTCTGGAGGCTGAAATGG + Intronic
961066691 3:123882682-123882704 TTGGACTCTGGATGCTGGATTGG - Intronic
961288044 3:125822386-125822408 TTCTCATCTGGAGGCTTGACTGG + Intergenic
961344991 3:126258567-126258589 CTGCCCTCTGAAGGCTGGACTGG + Intergenic
961899010 3:130193660-130193682 TTCTCATCTGGAGGCTTGACTGG - Intergenic
966789514 3:183653882-183653904 TGGCAATCAGGAGACTGGAGAGG - Intronic
968180176 3:196588873-196588895 TTGCAAACTTGAGGCTGGTAAGG + Exonic
969348751 4:6585737-6585759 GTGTCATCTGAAGGCTGGACTGG + Intronic
969437703 4:7198260-7198282 CTGCACTCTGGAGGCTGGCCTGG - Intronic
969489689 4:7491977-7491999 TTGCCTCCTGGAGGCTGGGCAGG + Intronic
969744366 4:9058150-9058172 TTCTCATCTGGAGGCTTGACTGG + Intergenic
974068537 4:57102973-57102995 TGGTAATTTGGAGGCAGGACTGG + Intronic
974847836 4:67372687-67372709 ATGCAAGCTGGAAGCTGGAAAGG - Intergenic
975373272 4:73612885-73612907 TTTCAATTTGGAGCCTGGAAAGG - Intronic
978010912 4:103682778-103682800 TTCTCATCTGGAGGCTGGACTGG + Intronic
981879798 4:149595834-149595856 TTCCAAAGTGGAGGCTGGTCTGG - Intergenic
984708259 4:182863581-182863603 CTGCAGCCTGGAGGCTGGAGGGG - Intergenic
984748557 4:183248914-183248936 TTGCAATATGGATGGTGAACTGG + Intronic
985615017 5:915023-915045 TTGCAGTGTGGAGGCTGGGGAGG + Intronic
987256958 5:16164890-16164912 TTGCTTTGTGGAGACTGGACTGG - Intronic
990464702 5:56061054-56061076 TTGCAGTGTGGAGAGTGGACTGG + Intergenic
992066907 5:73117639-73117661 TGGTCATCTGAAGGCTGGACTGG - Intergenic
992339204 5:75805133-75805155 ATGCAATCTAGAAGCTGGAAAGG + Intergenic
992831164 5:80594868-80594890 TCCCAATCTGGAAGCTGGAGAGG + Intergenic
994280220 5:97893061-97893083 TTCCAACTTGGAGGCTGAACTGG + Intergenic
995487777 5:112656584-112656606 TTGCCATCTAGAGACTTGACAGG + Intergenic
995775137 5:115717029-115717051 TTGTCATCTAGAGGCTGGACTGG + Intergenic
998947190 5:147352505-147352527 TTGCATTGTTGAGGCTGGACGGG - Intronic
999017220 5:148120075-148120097 TTGCCATCTGGACCCCGGACAGG - Exonic
999503814 5:152174560-152174582 CTGCACTTTGGAGGATGGACAGG - Intergenic
1000196216 5:158960911-158960933 TAGCAATCTGAAGGCTCGACCGG - Intronic
1001136818 5:169109407-169109429 TTTTCATCTGGAGGCTTGACTGG - Intronic
1002294602 5:178223388-178223410 TGGCCATGTGGAGGATGGACTGG - Intronic
1002993040 6:2255637-2255659 TTCTCATCTGGAGGCTTGACAGG + Intergenic
1003829037 6:9985755-9985777 TTGCAATCTGGTGTCTTAACTGG - Intronic
1004011328 6:11690804-11690826 TTCTCATCTGGAGGCTTGACTGG - Intergenic
1004981231 6:21027120-21027142 TAGCAATCTGGAGGTAGGGCGGG - Intronic
1005174715 6:23031648-23031670 TTGCATTCAGGAGGCCGGAGGGG + Intergenic
1006440713 6:34052038-34052060 CTGGCAGCTGGAGGCTGGACTGG - Intronic
1007900790 6:45410217-45410239 TGGCAATGTGGAGGATAGACTGG + Intronic
1008165431 6:48132580-48132602 TTGCAATCTGAAGGATGAATTGG + Intergenic
1011484275 6:87826301-87826323 TTGTAATTTGGAGGGTGAACTGG + Intergenic
1012606915 6:101168740-101168762 TTCTCATCTAGAGGCTGGACTGG - Intergenic
1013012759 6:106134866-106134888 ATGAAAGCTGGAGGGTGGACTGG - Intergenic
1013637686 6:112044689-112044711 TGGCAATGTTGAGGCTGGACTGG + Intergenic
1014049133 6:116931322-116931344 TTGCAAACTGGAAGCTGTAAGGG - Exonic
1014693980 6:124596014-124596036 TTACCTCCTGGAGGCTGGACTGG + Intronic
1018745003 6:166754998-166755020 GTGGAATCTGGAAGCTGGAAGGG - Intronic
1023658633 7:42451196-42451218 TTCTCATCTGGAGGCTGGACTGG - Intergenic
1023705864 7:42941283-42941305 ATGCAATTTGGAGGTAGGACAGG + Intronic
1026481707 7:70785180-70785202 ATGAAATCTGGAAGCTGGACGGG - Intronic
1028153417 7:87402218-87402240 CTGCATTCTGGATGGTGGACAGG + Exonic
1028162698 7:87504365-87504387 CTGCATTCTGGATGGTGGACAGG + Exonic
1029068967 7:97879666-97879688 TTCTCATCTGGAGGCTTGACTGG - Intergenic
1029880449 7:103803142-103803164 TTGCAATCATTAAGCTGGACAGG - Intronic
1030263512 7:107591506-107591528 TTAAAATCTGGAGGGTAGACTGG - Intronic
1032527267 7:132588185-132588207 TGTGAACCTGGAGGCTGGACAGG + Intronic
1033304440 7:140214189-140214211 TAGGAAACTGTAGGCTGGACTGG + Intergenic
1036251267 8:7164845-7164867 TTCTCATCTGGAGGCTTGACTGG - Intergenic
1036366220 8:8122615-8122637 TTCTCATCTGGAGGCTTGACTGG + Intergenic
1036884678 8:12543044-12543066 TTCTCATCTGGAGGCTTGACTGG - Intergenic
1040784887 8:51154254-51154276 TTCTCATCTGGAGGCTGGAGTGG + Intergenic
1041591358 8:59588507-59588529 TTGCAATCAGGTGGCAGGAAAGG + Intergenic
1043790441 8:84460360-84460382 TTGCAAAGTGAAGGCTGTACAGG + Intronic
1043983443 8:86666942-86666964 TTACAAACTGGAGTCTGGGCTGG + Exonic
1044882119 8:96734349-96734371 TTGCAACATGGAGAATGGACTGG - Intronic
1044919870 8:97157710-97157732 TTGCAATCTCTGGGATGGACTGG - Intergenic
1044998018 8:97855743-97855765 TTGCATTCTTGAGGATGGAAAGG - Intergenic
1045046328 8:98282391-98282413 CTGCAGTGTGGAGGATGGACTGG + Intronic
1045317255 8:101053810-101053832 TAGTCATCTGAAGGCTGGACTGG - Intergenic
1047700595 8:127445678-127445700 TTGCATGCTGGTGGCTGCACAGG - Intergenic
1049041622 8:140116271-140116293 CAGCTATCTGGAAGCTGGACAGG + Intronic
1049049752 8:140185330-140185352 TTGCACAGAGGAGGCTGGACAGG + Intronic
1049548465 8:143245805-143245827 TTCTCATCTGGGGGCTGGACTGG - Intergenic
1051795400 9:20863375-20863397 TTGGAATCTGATGGCTGGAGTGG - Intronic
1051901907 9:22052208-22052230 TTGGAATTTCGAGGCTGGATGGG + Intergenic
1052850603 9:33376221-33376243 CTGAAGTCTGGAGGCAGGACTGG + Intergenic
1056446206 9:86668241-86668263 TTGGAAGGTGGAGGCTGGAATGG + Intergenic
1056840154 9:89992322-89992344 TTGAAAGGTGGAGGCTGAACTGG + Intergenic
1057953861 9:99391661-99391683 TTGCAACCTGGAGGATGGAAGGG - Intergenic
1058180690 9:101794661-101794683 TTCTCATCTGGAGGCTTGACTGG - Intergenic
1059925382 9:119204187-119204209 TTGTCATCTGGGGGCTTGACTGG - Intronic
1185883488 X:3760998-3761020 TTGGAACCTGGAAGCAGGACAGG - Intergenic
1186675702 X:11815043-11815065 TAGTCATCTGGAGGCTTGACTGG - Intergenic
1189043554 X:37568500-37568522 TGGTAATCTGAAGGCTTGACTGG + Intronic
1195866531 X:109438746-109438768 TTGCATTCTGGTGGCTTTACAGG + Intronic
1198463559 X:136884981-136885003 TTGCAGTCTGGAGACTGTATTGG + Intergenic
1199736144 X:150688477-150688499 TTGCATGATGGAGGATGGACTGG - Intergenic
1200860528 Y:7987256-7987278 TTAAAATCTGAAGGCTGGAAGGG - Intergenic