ID: 1074524295

View in Genome Browser
Species Human (GRCh38)
Location 10:114250877-114250899
Sequence TGTGATTGCAATCTGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 231}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074524295_1074524305 25 Left 1074524295 10:114250877-114250899 CCAGCCTCCAGATTGCAATCACA 0: 1
1: 0
2: 0
3: 15
4: 231
Right 1074524305 10:114250925-114250947 TTATACAGATGAGGCAGGGGAGG No data
1074524295_1074524304 22 Left 1074524295 10:114250877-114250899 CCAGCCTCCAGATTGCAATCACA 0: 1
1: 0
2: 0
3: 15
4: 231
Right 1074524304 10:114250922-114250944 GGGTTATACAGATGAGGCAGGGG No data
1074524295_1074524298 1 Left 1074524295 10:114250877-114250899 CCAGCCTCCAGATTGCAATCACA 0: 1
1: 0
2: 0
3: 15
4: 231
Right 1074524298 10:114250901-114250923 GCACTTGTTCTGATCATCCTTGG No data
1074524295_1074524300 16 Left 1074524295 10:114250877-114250899 CCAGCCTCCAGATTGCAATCACA 0: 1
1: 0
2: 0
3: 15
4: 231
Right 1074524300 10:114250916-114250938 ATCCTTGGGTTATACAGATGAGG No data
1074524295_1074524302 20 Left 1074524295 10:114250877-114250899 CCAGCCTCCAGATTGCAATCACA 0: 1
1: 0
2: 0
3: 15
4: 231
Right 1074524302 10:114250920-114250942 TTGGGTTATACAGATGAGGCAGG No data
1074524295_1074524299 2 Left 1074524295 10:114250877-114250899 CCAGCCTCCAGATTGCAATCACA 0: 1
1: 0
2: 0
3: 15
4: 231
Right 1074524299 10:114250902-114250924 CACTTGTTCTGATCATCCTTGGG No data
1074524295_1074524303 21 Left 1074524295 10:114250877-114250899 CCAGCCTCCAGATTGCAATCACA 0: 1
1: 0
2: 0
3: 15
4: 231
Right 1074524303 10:114250921-114250943 TGGGTTATACAGATGAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074524295 Original CRISPR TGTGATTGCAATCTGGAGGC TGG (reversed) Intronic
901195909 1:7439636-7439658 TGGGCCTGCACTCTGGAGGCTGG - Intronic
901807606 1:11748230-11748252 TGAGACTGCAGTCTGGGGGCAGG - Intronic
901892977 1:12283913-12283935 TGTAAATCCCATCTGGAGGCAGG + Intronic
905694541 1:39965172-39965194 TGTGAGTGGAGGCTGGAGGCTGG - Intronic
906742996 1:48200701-48200723 TACCATGGCAATCTGGAGGCAGG - Intergenic
906935883 1:50213778-50213800 TTTGATGAAAATCTGGAGGCAGG - Intergenic
907263479 1:53239223-53239245 AGTGATTGCAATGTGCAGCCAGG - Intergenic
907650128 1:56286936-56286958 TGTGAATGCTAGCAGGAGGCTGG - Intergenic
908581143 1:65518771-65518793 TGTTATTGGAAACTGGAGGAAGG - Intronic
909574965 1:77164346-77164368 TTTGTATGCAATCTAGAGGCAGG + Intronic
910474378 1:87591325-87591347 TGTGTTTTCAGCCTGGAGGCAGG + Intergenic
910659919 1:89660746-89660768 TGAGCTTGCTGTCTGGAGGCAGG - Intronic
911474085 1:98354746-98354768 CTTGATTGCAATTTGGAGACTGG - Intergenic
911589889 1:99734854-99734876 TGTGATTTCCAGCTGCAGGCTGG - Intronic
914044436 1:144078820-144078842 TTTGTTTGCCATCTAGAGGCAGG - Intergenic
914133674 1:144881866-144881888 TTTGTTTGCCATCTAGAGGCAGG + Intergenic
917204648 1:172559909-172559931 TGGGATTCAATTCTGGAGGCGGG - Intronic
917696947 1:177534950-177534972 TGTGATTGGATCATGGAGGCGGG - Intergenic
918928910 1:190827154-190827176 TTTGATTGCCTTGTGGAGGCTGG - Intergenic
919290612 1:195624556-195624578 TGTGATTGAATTATGGAGGTGGG + Intergenic
920163304 1:204016618-204016640 TGTGATTGGCATCTGAAGTCGGG + Intergenic
920569543 1:207006189-207006211 GGTGATTGCTATCAGGTGGCAGG + Intergenic
1063986734 10:11512457-11512479 TGTGGTAGCAGTGTGGAGGCTGG - Intronic
1064259252 10:13771680-13771702 TGTGCTTGCCATCTGGAGATGGG - Intronic
1066956568 10:42178498-42178520 TTTGTTTGCCATCTAGAGGCAGG - Intergenic
1070415730 10:76187652-76187674 TGTTATTTCAATCTGGTTGCTGG + Intronic
1070843215 10:79502547-79502569 TGTGGCTGGAATCTGGAGCCAGG + Intergenic
1070930455 10:80257087-80257109 TGTGGCTGGAATCTGGAGCCAGG - Intergenic
1074524295 10:114250877-114250899 TGTGATTGCAATCTGGAGGCTGG - Intronic
1075259039 10:120946963-120946985 TGTGAATAAAATCTGGAGGAGGG + Intergenic
1075682387 10:124341986-124342008 TGTGACTGCAATATGGTGACAGG - Intergenic
1075740396 10:124692358-124692380 TGTGATTGCAAGCTGGATACCGG - Intronic
1077323617 11:1953702-1953724 TGTGACTGCCATCTAGTGGCAGG - Intronic
1078635647 11:13047224-13047246 AAGGATTGCAATCTGCAGGCTGG - Intergenic
1080364340 11:31553541-31553563 TGTAATTCCAATTTGCAGGCTGG - Intronic
1083591129 11:63895620-63895642 TGTGCTTACTTTCTGGAGGCTGG - Exonic
1084779098 11:71397059-71397081 TGTGGCTCCAGTCTGGAGGCCGG - Intergenic
1085049723 11:73374047-73374069 TGTGATGGGGACCTGGAGGCAGG - Intergenic
1086877030 11:92109734-92109756 TGTGGGTGAGATCTGGAGGCAGG - Intergenic
1202806604 11_KI270721v1_random:8897-8919 TGTGACTGCCATCTAGTGGCAGG - Intergenic
1093672048 12:21888570-21888592 TGTGATTCGTATTTGGAGGCAGG - Intronic
1093975930 12:25422267-25422289 TGTAGTTCCAATCTGAAGGCTGG + Intronic
1100699085 12:97127218-97127240 TGTGCTTGCTTTCTGTAGGCTGG + Intergenic
1103011352 12:117460761-117460783 TGGGTCTGCAATTTGGAGGCTGG + Exonic
1103667563 12:122582118-122582140 TGTGAAAACCATCTGGAGGCCGG + Intronic
1106104394 13:26721620-26721642 TGTTAACACAATCTGGAGGCAGG - Intergenic
1109342752 13:61082301-61082323 TGTTATTTCAATCTAGAAGCTGG + Intergenic
1110014578 13:70385697-70385719 GGTGATTGAATCCTGGAGGCAGG - Intergenic
1111116836 13:83789791-83789813 TTTGTTTGCAATGTGCAGGCTGG + Intergenic
1111369919 13:87304225-87304247 TGAGTTTGAAATCTGCAGGCTGG - Intergenic
1112597206 13:100818419-100818441 AGTGATTCTAATCTGCAGGCAGG + Intergenic
1114190185 14:20435081-20435103 TGTGACTTGAAGCTGGAGGCAGG - Intronic
1114887352 14:26870436-26870458 TGGGATTGCAATCTGGAATTAGG + Intergenic
1115701380 14:35956478-35956500 GGAGATTGGAAGCTGGAGGCAGG + Intergenic
1116359256 14:43972320-43972342 TGAGGTTGCAGTCGGGAGGCGGG + Intergenic
1116895870 14:50314193-50314215 GGTGATTGAATTATGGAGGCAGG + Intronic
1117256901 14:53986785-53986807 AGTGATTGAATTATGGAGGCGGG + Intergenic
1117449718 14:55839154-55839176 TCTGAATGCAATGTGGAGGATGG + Intergenic
1117634980 14:57733042-57733064 TGTTCTAGGAATCTGGAGGCTGG - Intronic
1120649315 14:87112490-87112512 TGTGAGTGGAATCTAGAAGCTGG - Intergenic
1121305949 14:92906994-92907016 TGTGTTTGCAGCCAGGAGGCTGG - Intergenic
1121858279 14:97290722-97290744 TGTAAATGCAATCTGCAGCCAGG + Intergenic
1124383409 15:29186462-29186484 TGGGACTGCAATCTGGAAGGAGG + Intronic
1124415214 15:29467964-29467986 TTTGTTTGGCATCTGGAGGCAGG - Intronic
1126136562 15:45397767-45397789 TGTGATTGGCATCTGAAGGTGGG + Intronic
1126948469 15:53852081-53852103 TGTGACTGGTATCTGGAGGTAGG + Intergenic
1128365946 15:67002994-67003016 TGTTATTGGAAACTGGAGGAAGG + Intergenic
1128805146 15:70525277-70525299 TGTTATTGCTATTTTGAGGCAGG + Intergenic
1129510508 15:76118263-76118285 TGAGATTGAAAACTTGAGGCCGG + Intronic
1131311689 15:91296382-91296404 TGTGAAGGGAATCTGGAGGAAGG + Exonic
1136644258 16:31596086-31596108 TGTGACTGTAATGTGGAGCCAGG - Intergenic
1136660864 16:31760487-31760509 TGTGACTGTAATGTGGAGCCAGG + Exonic
1137542937 16:49377360-49377382 TGTGACTCCACACTGGAGGCAGG + Intronic
1141652013 16:85397758-85397780 TGGGACTGCAATGTGGAGGAAGG + Intergenic
1143795228 17:9330704-9330726 TGTGTTGCCAAACTGGAGGCAGG - Intronic
1144607054 17:16676109-16676131 TGTGATTGCTTTGTGGAGACTGG + Intergenic
1145406290 17:22599032-22599054 TGTTGTTGCTATTTGGAGGCAGG - Intergenic
1146986360 17:37223297-37223319 TGTGATTGGAACCTAGAAGCTGG + Intronic
1148465799 17:47864638-47864660 TGTGATTGCAGCCTGGAAGCTGG - Intergenic
1149855609 17:60079725-60079747 TGTGATTGCAATCTGGTCAGTGG + Intergenic
1152889159 17:82870363-82870385 TGTGACTGCAATCTCGAGGTAGG + Exonic
1157653798 18:49364543-49364565 TCTGATTGCAATCTGGAGTTTGG - Intronic
1163800957 19:19365131-19365153 TGTGATTGTATTTTGGAGGTGGG - Intergenic
1165963256 19:39552993-39553015 TGTGATTTCAATGTGCAGACAGG - Intergenic
1166681442 19:44769817-44769839 TGTGATTAGATTCTGGTGGCAGG - Intergenic
1202683995 1_KI270712v1_random:32230-32252 TTTGTTTGCCATCTAGAGGCAGG - Intergenic
925065607 2:927258-927280 CATGATTCCAATCTGCAGGCAGG + Intergenic
925065619 2:927311-927333 CGTGATTCCAATCTGCAGGCAGG + Intergenic
925065632 2:927364-927386 CGTGATTCCAATCTGCAGGCAGG + Intergenic
925065669 2:927519-927541 CGTGATTCCAATCTGCAGGCAGG + Intergenic
928429333 2:31204913-31204935 TGTGATTGCCATCTGAAGTAGGG + Intronic
928501948 2:31905922-31905944 TGTGATGGCAATATGAAGGATGG - Intronic
928848463 2:35710027-35710049 TTTGATTGGATTATGGAGGCGGG - Intergenic
930713634 2:54572685-54572707 TATGATTTCAATTTGGAGGTGGG + Intronic
931119426 2:59199598-59199620 TGTGAATGCAGACTGGAGGGGGG + Intergenic
934159149 2:89231474-89231496 TTTGTTTGCCATCTAGAGGCAGG + Intergenic
934166010 2:89294762-89294784 TTTGTTTGCAATCTAGAGGCAGG + Intergenic
934201267 2:89887694-89887716 TTTGTTTGCAATCTAGAGGCAGG - Intergenic
934208123 2:89950951-89950973 TTTGTTTGCCATCTAGAGGCAGG - Intergenic
934247723 2:90322623-90322645 TTTGTTTGCCATCTAGAGGCAGG + Intergenic
934261600 2:91479978-91480000 TTTGTTTGCCATCTAGAGGCAGG - Intergenic
934304640 2:91810970-91810992 TTTGTTTGCCATCTAGAGGCAGG - Intergenic
934328617 2:92041780-92041802 TTTGTTTGCCATCTAGAGGCAGG + Intergenic
934466994 2:94272298-94272320 TTTGTTTGCCATCTAGAGGCAGG + Intergenic
936169501 2:110156045-110156067 AGTGATTGAATTATGGAGGCAGG + Intronic
936380008 2:111975963-111975985 TGTGATTGGCATCTAAAGGCTGG - Intronic
938645093 2:133322347-133322369 TGTGATTGAGATCCAGAGGCAGG + Intronic
939442019 2:142261629-142261651 TGTGTTTGCAGCCTGGAGGCGGG - Intergenic
942727655 2:179027268-179027290 AGTGATTGCATTATGAAGGCAGG + Intronic
943868687 2:192963133-192963155 TGGGACTTCACTCTGGAGGCAGG - Intergenic
944344316 2:198642776-198642798 TATGATATCAATATGGAGGCTGG - Intergenic
945901668 2:215545271-215545293 AGTGATTGCAATGTGTAGTCAGG - Intergenic
947104484 2:226654278-226654300 TGTGATTCCAGTCTGAAGGCTGG - Intergenic
947360117 2:229338290-229338312 TGTGATTGCAGTGTTGAGCCAGG + Intergenic
948439951 2:237980330-237980352 TGTGTTTCCCTTCTGGAGGCTGG + Intronic
948727351 2:239943187-239943209 TGTGCTTGGGATCTGGAGACAGG - Intronic
1170398702 20:15956943-15956965 TTTAATTGCACTCTGAAGGCTGG - Intronic
1172858921 20:38032297-38032319 TATGATTCCAGTCTGGAGGAAGG + Intronic
1173465459 20:43277500-43277522 TGAGCTTGCCATCAGGAGGCAGG - Intergenic
1173977579 20:47198574-47198596 TGTGATTCACAGCTGGAGGCGGG + Intergenic
1176342315 21:5710042-5710064 TGGGATTGTAGTCTGCAGGCCGG + Intergenic
1176474569 21:7142194-7142216 TGGGATTGTAGTCTGCAGGCCGG + Intergenic
1176502512 21:7614414-7614436 TGGGATTGTAGTCTGCAGGCCGG - Intergenic
1176536636 21:8108111-8108133 TGGGATTGTAGTCTGCAGGCCGG + Intergenic
1176586949 21:8596346-8596368 TTTGTTTGCCATCTAGAGGCAGG - Intergenic
1177068458 21:16469799-16469821 TTTGGTTGAAATCTGGAGGATGG + Intergenic
1179633570 21:42693269-42693291 GGTGGTTGCAATCTGCAGCCAGG - Intronic
1179725486 21:43339297-43339319 TGTGAGAGCCATCTGGGGGCAGG + Intergenic
1180269777 22:10573343-10573365 TTTGTTTGCCATCTAGAGGCAGG - Intergenic
1180588138 22:16911529-16911551 TTTGTTTGCCATCTAGAGGCAGG + Intergenic
949412953 3:3785649-3785671 GGTGATTGAATTCTGGGGGCGGG + Intronic
949995975 3:9617762-9617784 AGTCACTGCAATCTGAAGGCTGG - Intergenic
950746977 3:15098573-15098595 TGTGGTTGCGATCGTGAGGCCGG - Intronic
953572945 3:44086931-44086953 TGTGATTGGCATCTGAAGGTGGG - Intergenic
953908518 3:46880801-46880823 TGGGAGTGCAGTCTGGAAGCTGG + Intronic
956047968 3:65216647-65216669 TGTGAAGACAGTCTGGAGGCAGG - Intergenic
957415325 3:79894938-79894960 TGAGATTTGACTCTGGAGGCAGG + Intergenic
958072212 3:88628846-88628868 AGAGATTGGAGTCTGGAGGCAGG - Intergenic
958461974 3:94409563-94409585 GGTGATTATAATATGGAGGCAGG + Intergenic
959585712 3:108023286-108023308 TGTGAATGCTAACTGGAGCCTGG + Intergenic
959894916 3:111594658-111594680 TATAATTGCATTTTGGAGGCAGG + Exonic
960746440 3:120895344-120895366 TGTGATTTCAGTTTGGAGGGAGG - Intergenic
960904412 3:122585351-122585373 TGTCTCTCCAATCTGGAGGCTGG + Intronic
960948671 3:122984214-122984236 AGGGATTGGAAGCTGGAGGCGGG + Intronic
961461705 3:127054249-127054271 TGTCCTTGCAATATGGCGGCTGG + Intergenic
963345609 3:144093416-144093438 GGTGATTGCATTATGGGGGCAGG + Intergenic
964307722 3:155358593-155358615 TGTGATTGGAATCTGAAGTGAGG + Intergenic
966000024 3:174937697-174937719 TATGATTTCTATCTGAAGGCTGG + Intronic
967458726 3:189720888-189720910 TGTGATTGCCATGTGGCTGCTGG - Intronic
970463715 4:16302278-16302300 TATGCTGGCATTCTGGAGGCTGG + Intergenic
970725283 4:19036626-19036648 TTTTCTGGCAATCTGGAGGCGGG - Intergenic
970737062 4:19184363-19184385 TGTGATTGCGATCAGAAGACAGG - Intergenic
972689244 4:41380651-41380673 AGTGATTGCAATGTGCAGCCAGG + Intronic
975161840 4:71133574-71133596 TGCGTTTGCACTCTGGAGGAAGG - Intergenic
975729995 4:77328483-77328505 GGTGATTGAATTATGGAGGCAGG - Intronic
975737973 4:77400226-77400248 TGTGAATGCAAACTGCAGGAGGG + Intronic
975828759 4:78347218-78347240 AGTGATTGCAATATGGAAGAGGG - Intronic
977709045 4:100103453-100103475 TGAGATTGCAATATGCAAGCTGG - Intergenic
979266104 4:118704898-118704920 TGTGATTGGTATCTGAAGGTGGG + Intronic
980556088 4:134407548-134407570 GGTGATTGAATTATGGAGGCAGG + Intergenic
983587364 4:169370364-169370386 TGTGATTCTAGTCTGAAGGCTGG - Intergenic
986371380 5:7083723-7083745 TGTTGTTTCAATCTGGAAGCTGG - Intergenic
987383444 5:17307208-17307230 AATTGTTGCAATCTGGAGGCAGG - Intergenic
987922458 5:24301051-24301073 CTTGATTGCAATATTGAGGCAGG + Intergenic
990028207 5:51222245-51222267 AGTGATTGCAATCAGGAGTGAGG - Intergenic
990329457 5:54711765-54711787 GGTGATTGAATTATGGAGGCAGG + Intergenic
990359492 5:55004117-55004139 TGTGAATGCAATCTGTAGACTGG + Intronic
990606412 5:57415000-57415022 TGTCACTGGAATCTGCAGGCAGG - Intergenic
990864798 5:60368681-60368703 TGTGATTGCATCATGGGGGCGGG + Intronic
991089936 5:62684573-62684595 GGTGATTGCAATGTGCAGTCAGG - Intergenic
991914123 5:71588997-71589019 TGTGGTGGCAATGTGGAGGATGG + Intronic
992080657 5:73232703-73232725 TGTGATCTCTATTTGGAGGCAGG + Intergenic
996125102 5:119716801-119716823 TATGATTGCCATCTGGAGTATGG + Intergenic
996882627 5:128317244-128317266 TGTGTTTACATTCTAGAGGCAGG - Intronic
999675892 5:154002360-154002382 TGCGTTTGCAATCCGGAGCCTGG - Exonic
999923901 5:156354281-156354303 TGTGATTATAGTCTGGAAGCTGG + Intronic
1000686628 5:164257389-164257411 TGTGACTGCAGCCTGGAGGAAGG + Intergenic
1001690243 5:173627547-173627569 TGGGGTTGTAATCTGGAGGTAGG + Intergenic
1003159162 6:3620478-3620500 TGTGGTTGTGACCTGGAGGCTGG - Intergenic
1003507215 6:6750019-6750041 TGGGATTGAAGGCTGGAGGCTGG - Intergenic
1005085460 6:22001774-22001796 TGTGACTGCAACCTGGACTCAGG - Intergenic
1006087991 6:31610236-31610258 TGTGATTGGTATCTGGAGTGGGG + Intergenic
1006761025 6:36460755-36460777 TGTGATTTCAAGCTGAAGACCGG - Intronic
1007075785 6:39065345-39065367 TGTGATTTGAGGCTGGAGGCAGG + Intronic
1007230056 6:40341945-40341967 TGTGATTGGAGTCTGGAGTGGGG + Intergenic
1010549177 6:77200403-77200425 GGTGATTGCATTATGGATGCAGG + Intergenic
1012213886 6:96558002-96558024 GGTGATTGAAATGTGGGGGCAGG - Intergenic
1012683341 6:102210429-102210451 GGTGATTGCATTATGGGGGCAGG + Intergenic
1014446252 6:121531425-121531447 CTTGATTGCAGTCAGGAGGCTGG + Intergenic
1020781508 7:12521689-12521711 TGTGATAGCAGTATGGAGGGTGG - Intergenic
1020782830 7:12537361-12537383 GGTGATTGAATTCTGGGGGCAGG - Intergenic
1022636964 7:32145142-32145164 TGTGATGGCAAAATGTAGGCTGG + Intronic
1024103400 7:46056825-46056847 TGTGATTGGCATCTGGGGTCAGG + Intergenic
1024588936 7:50864408-50864430 TGTGATTGGCATCTGAAGCCGGG + Intergenic
1029154178 7:98503235-98503257 AGTGATTGACACCTGGAGGCAGG + Intergenic
1030559225 7:111064255-111064277 TGTGATTGAATTATGGGGGCAGG - Intronic
1030635807 7:111947565-111947587 TATTATTCCAAACTGGAGGCTGG + Intronic
1030695251 7:112578032-112578054 TGTGAGTGCAATATGCAGACAGG - Intergenic
1031700013 7:124913140-124913162 GGTGATTGAATTATGGAGGCGGG - Intronic
1031809808 7:126352370-126352392 TGTGATGGTAATTTGGAGGCAGG - Intergenic
1033067405 7:138169181-138169203 TGTGATTCCCATGGGGAGGCTGG + Intergenic
1033403133 7:141046438-141046460 GGTGATTGAATTATGGAGGCGGG - Intergenic
1034757954 7:153640683-153640705 GGCGATTGCATTTTGGAGGCAGG + Intergenic
1036059661 8:5301790-5301812 GGTAATTGAATTCTGGAGGCAGG - Intergenic
1036971476 8:13360273-13360295 TGTGATTCTAATGTGCAGGCTGG - Intronic
1039354776 8:36802832-36802854 TGTGATGTCAATGTGGGGGCAGG + Intronic
1041315575 8:56558601-56558623 TGCGAGTGCACTGTGGAGGCAGG + Intergenic
1042033450 8:64503346-64503368 GGTGATTGAATTTTGGAGGCGGG - Intergenic
1043224215 8:77702010-77702032 TGTGCCTGCAATCTGGGGCCAGG + Intergenic
1045471872 8:102519931-102519953 TGTGTATCCAACCTGGAGGCAGG + Intergenic
1045482691 8:102605031-102605053 TGTGAATGCAATGTGGTGGCAGG + Intergenic
1046008109 8:108510285-108510307 TGTGATTTCAGTTTGGAGGATGG - Intergenic
1046400824 8:113701964-113701986 TGTGATCGAATTCTGGAGGTAGG - Intergenic
1047085821 8:121514125-121514147 TGTGATGGAAAGCTGGAGTCGGG - Intergenic
1048437654 8:134433020-134433042 GGTGATTGCAATATGCAGCCAGG - Intergenic
1048447635 8:134503797-134503819 TGTGACTCCAATTTGAAGGCTGG - Intronic
1051600741 9:18870824-18870846 TATGATTGCTATCTGCAGGAAGG + Intronic
1053697044 9:40649102-40649124 TTTGTTTGCCATCTAGAGGCAGG + Intergenic
1053943438 9:43279241-43279263 TTTGTTTGCCATCTAGAGGCAGG + Intergenic
1054308296 9:63448335-63448357 TTTGTTTGCCATCTAGAGGCAGG + Intergenic
1054407032 9:64772321-64772343 TTTGTTTGCCATCTAGAGGCAGG + Intergenic
1054440656 9:65257792-65257814 TTTGTTTGCCATCTAGAGGCAGG + Intergenic
1054489752 9:65764141-65764163 TTTGTTTGCCATCTAGAGGCAGG - Intergenic
1056134834 9:83621906-83621928 TGAGATTTCAATCTGGATGGGGG - Intergenic
1056233813 9:84572175-84572197 TATAAGTGCTATCTGGAGGCAGG - Intergenic
1057029635 9:91765609-91765631 TGTGTTTCCCATCTGGAGCCAGG + Intronic
1058727736 9:107819222-107819244 AGTGATTGAAATATGGAGCCGGG + Intergenic
1059064948 9:111073608-111073630 AGTGATTCCAATATGTAGGCAGG + Intergenic
1061926602 9:133808948-133808970 TGGGAGTGCATTCCGGAGGCAGG - Intronic
1062149543 9:135010573-135010595 TGGGACTGGACTCTGGAGGCGGG - Intergenic
1062340172 9:136090624-136090646 TGATGTTGGAATCTGGAGGCTGG - Intronic
1062353639 9:136151832-136151854 TATGATTGAAATTTGAAGGCTGG + Intergenic
1202779498 9_KI270717v1_random:22761-22783 TTTGTTTGCCATCTAGAGGCAGG + Intergenic
1203586558 Un_KI270747v1:9146-9168 TTTGTTTGCCATCTAGAGGCAGG + Intergenic
1186519069 X:10189468-10189490 TGTGATTGTAATGTGCAGCCAGG + Intronic
1186896060 X:14005687-14005709 TGTGATTGGCATCTGAAGTCGGG + Intergenic
1188022344 X:25172592-25172614 TGTGACTGCAACATGGTGGCAGG + Intergenic
1188602376 X:31983924-31983946 TGTGATAACAATCTGGGGCCTGG - Intronic
1188856969 X:35208852-35208874 TGTGAAAGCAATCAGGAGGGAGG - Intergenic
1189367449 X:40399846-40399868 TGTGACTAAATTCTGGAGGCAGG - Intergenic
1189381183 X:40503453-40503475 TGTCAAAACAATCTGGAGGCAGG - Intergenic
1194788245 X:98113458-98113480 TGTCATTGGAATCTGAAGTCAGG + Intergenic
1195851301 X:109284656-109284678 AGTGATTGCAAACTGGTGGCTGG - Intergenic
1199762147 X:150913075-150913097 TCTGATTGCCATGTGGAGCCTGG - Intergenic
1201194764 Y:11481047-11481069 TTTGTTTGCCATCTAGAGGCAGG + Intergenic
1201341251 Y:12936557-12936579 TGAGATTGGAATCAGGAGTCTGG + Intergenic
1201593263 Y:15638105-15638127 AGTGATTGAATTATGGAGGCAGG + Intergenic