ID: 1074524296

View in Genome Browser
Species Human (GRCh38)
Location 10:114250881-114250903
Sequence TGCATGTGATTGCAATCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 124}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074524296_1074524304 18 Left 1074524296 10:114250881-114250903 CCTCCAGATTGCAATCACATGCA 0: 1
1: 0
2: 0
3: 7
4: 124
Right 1074524304 10:114250922-114250944 GGGTTATACAGATGAGGCAGGGG No data
1074524296_1074524300 12 Left 1074524296 10:114250881-114250903 CCTCCAGATTGCAATCACATGCA 0: 1
1: 0
2: 0
3: 7
4: 124
Right 1074524300 10:114250916-114250938 ATCCTTGGGTTATACAGATGAGG No data
1074524296_1074524299 -2 Left 1074524296 10:114250881-114250903 CCTCCAGATTGCAATCACATGCA 0: 1
1: 0
2: 0
3: 7
4: 124
Right 1074524299 10:114250902-114250924 CACTTGTTCTGATCATCCTTGGG No data
1074524296_1074524303 17 Left 1074524296 10:114250881-114250903 CCTCCAGATTGCAATCACATGCA 0: 1
1: 0
2: 0
3: 7
4: 124
Right 1074524303 10:114250921-114250943 TGGGTTATACAGATGAGGCAGGG No data
1074524296_1074524302 16 Left 1074524296 10:114250881-114250903 CCTCCAGATTGCAATCACATGCA 0: 1
1: 0
2: 0
3: 7
4: 124
Right 1074524302 10:114250920-114250942 TTGGGTTATACAGATGAGGCAGG No data
1074524296_1074524305 21 Left 1074524296 10:114250881-114250903 CCTCCAGATTGCAATCACATGCA 0: 1
1: 0
2: 0
3: 7
4: 124
Right 1074524305 10:114250925-114250947 TTATACAGATGAGGCAGGGGAGG No data
1074524296_1074524298 -3 Left 1074524296 10:114250881-114250903 CCTCCAGATTGCAATCACATGCA 0: 1
1: 0
2: 0
3: 7
4: 124
Right 1074524298 10:114250901-114250923 GCACTTGTTCTGATCATCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074524296 Original CRISPR TGCATGTGATTGCAATCTGG AGG (reversed) Intronic
905982587 1:42243314-42243336 TGCTTATTATTGCAATTTGGTGG - Intronic
906231529 1:44169120-44169142 TGCATGTGTATGCCATCTAGGGG - Intergenic
908285198 1:62590034-62590056 TCCATGTCATTGTACTCTGGTGG - Intronic
909366647 1:74831528-74831550 TGCATGTGAATGCAATTGGCTGG + Intergenic
910734300 1:90435183-90435205 TGCATTTAATGGTAATCTGGTGG - Intergenic
912591379 1:110824392-110824414 TGCAGGTGAGTGCACACTGGTGG + Intergenic
916317721 1:163469141-163469163 TCCATGTCACTCCAATCTGGTGG + Intergenic
920365131 1:205444267-205444289 TGCATCTGACTGCAAGCTGTTGG + Intronic
923389539 1:233500412-233500434 TGCCTTTGATTGCAAACTTGAGG - Intergenic
923809792 1:237300685-237300707 TGCATCTGATGGCAAACTGTAGG - Intronic
1063671975 10:8106262-8106284 TGCATGTGAGTGCAGTTTTGGGG + Intergenic
1065781203 10:29169620-29169642 AGCATGTGATTGGAAACTGGAGG - Intergenic
1068905762 10:62320100-62320122 CTCATGTGATTACAATCTGCTGG + Intergenic
1074524296 10:114250881-114250903 TGCATGTGATTGCAATCTGGAGG - Intronic
1074560979 10:114534910-114534932 TGCATGGGAATGCAGTCTGCTGG + Intronic
1078378207 11:10814625-10814647 TACATGTGACTACAATTTGGAGG + Intronic
1079486386 11:20940001-20940023 CACATGCAATTGCAATCTGGTGG + Intronic
1079941654 11:26688129-26688151 TGCTGTTGGTTGCAATCTGGTGG - Intronic
1082052813 11:47786531-47786553 TGCATCAAATTGCAATTTGGAGG - Exonic
1087257140 11:95968768-95968790 TGCATATGAATGCCCTCTGGTGG + Intergenic
1093858225 12:24131741-24131763 TTCATGTGATTGCCATGTGTAGG + Intergenic
1094441618 12:30484050-30484072 TCCATTTGATTGCAATACGGGGG - Intergenic
1098481914 12:70972002-70972024 AGCATGTTATTGCAATCTCTGGG - Intergenic
1099691040 12:85952016-85952038 TGCATTATATTGCCATCTGGAGG + Intergenic
1103164393 12:118757576-118757598 TATATGAGATTGCAATCTGTTGG + Intergenic
1107382512 13:39872280-39872302 TGGAGGTGATTGAAATTTGGTGG + Intergenic
1111099869 13:83569965-83569987 TGCATTTGAGTGAAATTTGGAGG + Intergenic
1116287339 14:42989370-42989392 TGGATGTGATTTCATTCTGCTGG + Intergenic
1118643128 14:67811080-67811102 TGCCTGTGATTGGAAGCTGGTGG + Intronic
1119394001 14:74312352-74312374 TGAAGTTGATTGCAATCTGTAGG + Intronic
1119783811 14:77297666-77297688 TGCAGGTGATTGCTTCCTGGAGG - Intronic
1121234418 14:92381734-92381756 TGCAGGTGATTCCAATGTGCAGG - Intronic
1122499555 14:102187692-102187714 TGCATGTGATTGGAAATGGGTGG + Intronic
1124239290 15:28016890-28016912 TGCAACTGCTTGCAACCTGGAGG + Intronic
1128365945 15:67002990-67003012 AGCATGTTATTGGAAACTGGAGG + Intergenic
1128527229 15:68420917-68420939 TGCATGTGAATGCATGCAGGGGG + Intronic
1134886278 16:17795592-17795614 TGCCTGTGCTTCCAAGCTGGTGG - Intergenic
1150856024 17:68753570-68753592 TGCATTGGATTCCAATCTTGAGG - Intergenic
1152560271 17:81075193-81075215 TGCCTGTGATTTCAAGCCGGCGG + Intronic
1203166522 17_GL000205v2_random:102168-102190 TGCAGGTGATTACAATGTGTAGG - Intergenic
1153086157 18:1290289-1290311 TGCATATGATTGCATTGTTGTGG - Intergenic
1161200001 19:3009390-3009412 TGCATGGGAAGACAATCTGGGGG - Intronic
1162494716 19:11017311-11017333 GGAATCTGACTGCAATCTGGAGG - Intronic
1162813985 19:13182100-13182122 GGCATGTGTTAGCAAGCTGGGGG + Intergenic
1164845282 19:31427152-31427174 TGCATGTGATTGCTGGCTGGTGG + Intergenic
931384339 2:61783938-61783960 TGAATATGATTCCAATCTGAGGG + Intergenic
932924727 2:75959833-75959855 TGCCTGTGATTCCACTCAGGTGG + Intergenic
935387755 2:102519026-102519048 TGTATTTGATTACAATCTAGTGG - Intronic
939176194 2:138750525-138750547 TGAATGAGATTTCAATCTGCTGG - Intronic
939303624 2:140380456-140380478 TGCATGTGTCTGCAACCAGGAGG - Intronic
944048586 2:195440515-195440537 TGCATAGGATTGCTGTCTGGAGG + Intergenic
945522559 2:210846366-210846388 TCCATCTGATTGCTTTCTGGGGG + Intergenic
948243192 2:236455817-236455839 TGCATTTGCTGGCAATCTGGAGG + Intronic
1168983642 20:2028645-2028667 TGCCAGTGATTACAATTTGGTGG + Intergenic
1170381008 20:15759620-15759642 TACATGTGATTGCACTCTACCGG + Intronic
1170942100 20:20856570-20856592 TGGATGTGAGTGAGATCTGGAGG + Intergenic
1172187687 20:33041528-33041550 GCCATGTGATGGCCATCTGGTGG - Intronic
1173478073 20:43377081-43377103 TTCATGTGATTCCAATGTGTAGG - Intergenic
1174993357 20:55538303-55538325 TACATGTGCTTCAAATCTGGTGG + Intergenic
1176335016 21:5588377-5588399 TGCAGGTGATTACAATGTGTAGG + Intergenic
1176392741 21:6232571-6232593 TGCAGGTGATTACAATGTGTAGG - Intergenic
1176405233 21:6356928-6356950 TGCAGGTGATTACAATGTGTAGG + Intergenic
1176431924 21:6632175-6632197 TGCAGGTGATTACAATGTGTAGG - Intergenic
1176468678 21:7083603-7083625 TGCAGGTGATTACAATGTGTAGG + Intronic
1176492239 21:7465381-7465403 TGCAGGTGATTACAATGTGTAGG + Intergenic
1176508403 21:7673002-7673024 TGCAGGTGATTACAATGTGTAGG - Intergenic
1179373880 21:40831729-40831751 TTCATGAGATTGCATTCTGTTGG - Intronic
1183300217 22:37055326-37055348 TGGATGTGAGGGCGATCTGGCGG - Intronic
1183598212 22:38824889-38824911 TGCATTTCATGGCATTCTGGAGG - Intronic
949093769 3:61529-61551 AGCATGTTATTGGAAACTGGAGG + Intergenic
949410341 3:3756643-3756665 GGCATGGGATTGCAATTTGCTGG + Intronic
949434685 3:4015978-4016000 TGCATTTGATCACAACCTGGGGG - Intronic
949730458 3:7106402-7106424 AGCATGTGATTACAATATAGGGG - Intronic
956437710 3:69250193-69250215 TGCATTTGATCGTAAACTGGAGG - Intronic
956683093 3:71799629-71799651 TGGATGGGCTTGCAATGTGGAGG + Intergenic
960746442 3:120895348-120895370 TGCATGTGATTTCAGTTTGGAGG - Intergenic
960823746 3:121760889-121760911 TGCAGGTGATTGAGATTTGGGGG + Intergenic
964165217 3:153696325-153696347 TGCAAGTAATTCCTATCTGGTGG + Intergenic
967354590 3:188553970-188553992 TTCATGGGATTGCAGGCTGGGGG + Intronic
970158902 4:13169639-13169661 TGCTTGTGATTGCATGTTGGTGG - Intergenic
971919346 4:32916641-32916663 TGCATGTTATTTAAATCTGTTGG - Intergenic
972786170 4:42328599-42328621 AGCATGTATTTGCCATCTGGGGG - Intergenic
973543302 4:51955833-51955855 AGCATGTTATTGGAAACTGGAGG + Intergenic
975737971 4:77400222-77400244 TGCATGTGAATGCAAACTGCAGG + Intronic
976320138 4:83704856-83704878 TACATGAGATTGCAGTCTAGAGG + Intergenic
978745224 4:112185785-112185807 AGCAGCTGATTGCAATTTGGGGG - Intronic
980403033 4:132317941-132317963 TGCATTTGATGGCAACCTGAGGG - Intergenic
980457729 4:133067607-133067629 TGCTTGTTATTGTAGTCTGGTGG + Intergenic
985177460 4:187216585-187216607 TGCATTTGTTTGCAACCTGAGGG + Intergenic
987198050 5:15547226-15547248 TGCTTATGTTTGCAATCTTGGGG + Intronic
989763420 5:45048964-45048986 TGCATGAGATTTGAAACTGGAGG - Intergenic
991630638 5:68653467-68653489 TGCATGTGACTTCCATCTTGTGG - Intergenic
993095782 5:83475980-83476002 TCCCTGTGTTTGCAAACTGGAGG + Intronic
993102916 5:83563365-83563387 GGCATTTGTTTGCAGTCTGGAGG - Intronic
996248776 5:121300619-121300641 AACATGTTATTGCAAACTGGAGG - Intergenic
998765335 5:145480266-145480288 TGCAGGTGATTGCTATATGATGG - Intronic
1000548169 5:162626709-162626731 TGCATGAGATTTCTATGTGGGGG - Intergenic
1002270401 5:178067984-178068006 AGCAAGTGATTACAAGCTGGTGG - Intergenic
1002980585 6:2132472-2132494 TGGATGTGTGTGAAATCTGGAGG - Intronic
1010277629 6:73988266-73988288 TGCCTGGGATTTCAATCTGTGGG - Intergenic
1010730392 6:79384696-79384718 GGCATATGAGTGAAATCTGGAGG + Intergenic
1012600462 6:101091267-101091289 TCCTTGTGATTGAAATCTGTTGG + Intergenic
1014004715 6:116405027-116405049 TGCCTGTGATTGCAAACTTCTGG + Intronic
1016319828 6:142830841-142830863 TGGATGTGCATGCATTCTGGGGG - Intronic
1020766497 7:12328462-12328484 GGCATGTGATTGGCATCTGAAGG + Intergenic
1020878815 7:13732857-13732879 TATAAGTGATTGCAATCTGATGG - Intergenic
1027639897 7:80720033-80720055 TGCCTGTAATCCCAATCTGGAGG - Intergenic
1027706079 7:81535499-81535521 TGCATTCTATTGCAAACTGGAGG - Intergenic
1029166404 7:98594635-98594657 TGCATGGGATTGGATTCTTGGGG - Intergenic
1030695797 7:112583433-112583455 TGCATGTGATTGAAATGAGTGGG - Intergenic
1032484811 7:132277438-132277460 TGCAGGAGAGTGCAGTCTGGAGG + Intronic
1032566936 7:132956128-132956150 TGTGTCTGAATGCAATCTGGAGG - Intronic
1034934815 7:155192011-155192033 TGCAAATGATTTCAGTCTGGTGG + Intergenic
1036168689 8:6462048-6462070 TGCATGTGAAGGCAAGCTGTGGG + Intronic
1038712240 8:29958362-29958384 TGCATGTGGTTGGAAGCTGCTGG + Intergenic
1044389412 8:91631930-91631952 TGCATGGGAATGCACTGTGGTGG + Intergenic
1044418431 8:91962934-91962956 TACATCTGATTTCAATCTGAAGG - Intronic
1045607973 8:103799631-103799653 TTCATGTGTTTGCAGTCTGGTGG + Intronic
1045678803 8:104636886-104636908 AGCAGGTGATTGGAACCTGGGGG - Intronic
1047319103 8:123762820-123762842 TGGAAGTGAATGCCATCTGGAGG - Intergenic
1051577354 9:18632129-18632151 AGGATGTGAGAGCAATCTGGTGG - Intronic
1052708929 9:32028617-32028639 TCAATTTGTTTGCAATCTGGTGG - Intergenic
1055770256 9:79709202-79709224 TACATGTGATTATAATCTTGAGG + Intronic
1057999641 9:99851762-99851784 TGCAAGTGCTTTGAATCTGGTGG + Intronic
1058254133 9:102739578-102739600 TGCCTGTGATTGCAAGCAGTTGG - Intergenic
1059099480 9:111455853-111455875 GTCATGTGAGTGAAATCTGGAGG - Intronic
1060404495 9:123366490-123366512 TGTGTGTGATTGCAACCTGTCGG + Intronic
1203426624 Un_GL000195v1:46539-46561 TGCAGGTGATTACAATGTGTAGG - Intergenic
1203439615 Un_GL000195v1:176533-176555 TGCAGGTGATTACAATGTGTAGG + Intergenic
1194726014 X:97398383-97398405 TGCATGTGAATGTACTGTGGGGG - Intronic
1196960785 X:120998716-120998738 TTCATGGGATTTCAATCTAGTGG + Intergenic
1197820412 X:130535899-130535921 AGCATATGATTGCTATTTGGAGG + Intergenic