ID: 1074524297

View in Genome Browser
Species Human (GRCh38)
Location 10:114250884-114250906
Sequence AAGTGCATGTGATTGCAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 143}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074524297_1074524304 15 Left 1074524297 10:114250884-114250906 CCAGATTGCAATCACATGCACTT 0: 1
1: 0
2: 0
3: 5
4: 143
Right 1074524304 10:114250922-114250944 GGGTTATACAGATGAGGCAGGGG No data
1074524297_1074524298 -6 Left 1074524297 10:114250884-114250906 CCAGATTGCAATCACATGCACTT 0: 1
1: 0
2: 0
3: 5
4: 143
Right 1074524298 10:114250901-114250923 GCACTTGTTCTGATCATCCTTGG No data
1074524297_1074524303 14 Left 1074524297 10:114250884-114250906 CCAGATTGCAATCACATGCACTT 0: 1
1: 0
2: 0
3: 5
4: 143
Right 1074524303 10:114250921-114250943 TGGGTTATACAGATGAGGCAGGG No data
1074524297_1074524299 -5 Left 1074524297 10:114250884-114250906 CCAGATTGCAATCACATGCACTT 0: 1
1: 0
2: 0
3: 5
4: 143
Right 1074524299 10:114250902-114250924 CACTTGTTCTGATCATCCTTGGG No data
1074524297_1074524300 9 Left 1074524297 10:114250884-114250906 CCAGATTGCAATCACATGCACTT 0: 1
1: 0
2: 0
3: 5
4: 143
Right 1074524300 10:114250916-114250938 ATCCTTGGGTTATACAGATGAGG No data
1074524297_1074524305 18 Left 1074524297 10:114250884-114250906 CCAGATTGCAATCACATGCACTT 0: 1
1: 0
2: 0
3: 5
4: 143
Right 1074524305 10:114250925-114250947 TTATACAGATGAGGCAGGGGAGG No data
1074524297_1074524302 13 Left 1074524297 10:114250884-114250906 CCAGATTGCAATCACATGCACTT 0: 1
1: 0
2: 0
3: 5
4: 143
Right 1074524302 10:114250920-114250942 TTGGGTTATACAGATGAGGCAGG No data
1074524297_1074524306 28 Left 1074524297 10:114250884-114250906 CCAGATTGCAATCACATGCACTT 0: 1
1: 0
2: 0
3: 5
4: 143
Right 1074524306 10:114250935-114250957 GAGGCAGGGGAGGCCCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074524297 Original CRISPR AAGTGCATGTGATTGCAATC TGG (reversed) Intronic
905535429 1:38717845-38717867 AACTGCCTCTGATTGCCATCAGG - Intergenic
909477979 1:76103824-76103846 GAATACATGTGATTGCATTCAGG + Intronic
913376895 1:118162319-118162341 AAGGCCATGTGGTTGGAATCAGG - Intronic
922623387 1:227010281-227010303 AAATGCATGTAATTCCAACCAGG - Intronic
923048375 1:230372059-230372081 CAGTGCAAGTGATAGCAAGCAGG + Intronic
1064064141 10:12166322-12166344 CAATGCCTGTGATTGAAATCAGG + Exonic
1068606880 10:59015236-59015258 AAGAGAATGTGATTGCAACTTGG + Intergenic
1070489862 10:76966367-76966389 AACTGAATGTGATTGTAACCAGG + Intronic
1070526502 10:77300092-77300114 AAGTGAATGGGAATGAAATCTGG - Intronic
1071098012 10:82001829-82001851 AAGTGCATGTAAATGCTCTCAGG + Intronic
1074524297 10:114250884-114250906 AAGTGCATGTGATTGCAATCTGG - Intronic
1075259657 10:120951642-120951664 AAGTGCAAGTTATTGCTTTCTGG + Intergenic
1077142921 11:1032484-1032506 GAGTGCATGTGTGTGCATTCGGG + Intronic
1084656292 11:70521339-70521361 ATTTGCATGTCATTGCAAACTGG - Intronic
1086768482 11:90729590-90729612 TAGTGAATGGGATTGCATTCTGG + Intergenic
1088325814 11:108600003-108600025 GAGTCCAGGAGATTGCAATCTGG + Intergenic
1088344629 11:108808876-108808898 ACGTCCATGTGCTTGCAATTAGG + Intronic
1089221631 11:116876848-116876870 CTTTGCATGTGATTGTAATCAGG - Intronic
1090102808 11:123818722-123818744 AAGAGCATGGGATTGGCATCTGG + Intergenic
1091996891 12:5000834-5000856 AAGAGCATGTGAATGCAAAGAGG - Intergenic
1093978843 12:25452918-25452940 AGGTGCCTGTGAAAGCAATCAGG - Intronic
1094014369 12:25846815-25846837 GAGTGCATGTGGTTCCAGTCAGG - Intergenic
1095135068 12:38590635-38590657 AAGTGAAGATGATTGCCATCAGG - Intergenic
1095600696 12:44009990-44010012 AAGTGCCTGTGAGTGCCCTCAGG + Intronic
1095831683 12:46593305-46593327 AAGTGCATGTGATTTTATTGTGG + Intergenic
1097069463 12:56344244-56344266 AAGAGCATGGGTTTGGAATCAGG + Intronic
1097128258 12:56790423-56790445 AAGTGCCTGCGATTGCAGGCGGG - Intergenic
1099922766 12:88979856-88979878 AACTTCAAGTTATTGCAATCTGG - Intergenic
1100017253 12:90025509-90025531 GAGTCCATGTGATTGCATTTAGG + Intergenic
1101145302 12:101835082-101835104 AAGATCACGTCATTGCAATCTGG - Intergenic
1102358953 12:112267073-112267095 AATTGGATGTGAGGGCAATCTGG + Intronic
1108014949 13:46064920-46064942 GAGTGGATGTGATTGAAACCCGG - Intronic
1122499554 14:102187689-102187711 AATTGCATGTGATTGGAAATGGG + Intronic
1124209704 15:27752866-27752888 AAGTGCAAGTGACTGCAGCCAGG - Intergenic
1128707542 15:69848437-69848459 AAGGAAATGTGATTGCAAACAGG - Intergenic
1131615191 15:94008742-94008764 AAGTGCATCTGAAGGCAGTCTGG - Intergenic
1133645359 16:7759243-7759265 AAGGGCATGCTATTGGAATCAGG + Intergenic
1135407866 16:22211026-22211048 AAGGTCATGTGACTGCATTCTGG - Intronic
1137352087 16:47722283-47722305 AAGTCCATGTGATGCCAGTCTGG - Intergenic
1138212021 16:55171432-55171454 AAGTTCATGTAATTGCCAACAGG - Intergenic
1139444044 16:66985843-66985865 AAGATCATGTTATTGCACTCCGG + Intergenic
1146057937 17:29590279-29590301 AAGTGGATGTGAGTGCACACAGG - Intronic
1149430252 17:56592043-56592065 TGGTGAATGTGATTGGAATCTGG - Intergenic
1157898438 18:51490563-51490585 AAGTGCATGCGGTTTCAAACAGG - Intergenic
1160272337 18:77398359-77398381 AGGTGCAGCTGATGGCAATCAGG + Intergenic
1162324892 19:9993194-9993216 AAGTTCATGGGATTCCATTCAGG + Intronic
1163002195 19:14375477-14375499 GAGTGCATGTGTTTGCGACCTGG - Intergenic
1168649007 19:58081035-58081057 ATGTGCATATGATTGCACACAGG - Intronic
926691213 2:15735292-15735314 AAGAGCATGTGACTCCAAACAGG + Intronic
926791753 2:16579396-16579418 ATGTGCATGTGATTTTAATAAGG - Intronic
929119039 2:38468751-38468773 AAGTGCAACTGATTTCATTCCGG + Intergenic
930744370 2:54866354-54866376 AAGTGAATGTGATTCCAAAGAGG + Intronic
932924726 2:75959830-75959852 AAGTGCCTGTGATTCCACTCAGG + Intergenic
936274019 2:111076966-111076988 AGATGCATGTGATTGCATTTAGG + Intronic
938742704 2:134248060-134248082 AAGTGGATGTGATGGTAGTCAGG - Intronic
939303625 2:140380459-140380481 AACTGCATGTGTCTGCAACCAGG - Intronic
940777842 2:157903285-157903307 AAATGGATGTTATTGAAATCCGG + Intronic
942118945 2:172757620-172757642 AAGTGCATGTATTTGCCTTCTGG + Intronic
942633754 2:177979200-177979222 AATAGCAAGGGATTGCAATCTGG - Intronic
945507593 2:210660253-210660275 CAGTGCATGGGAATGCAATTTGG + Intronic
946760058 2:222984523-222984545 AATTGGTTGTGACTGCAATCAGG - Intergenic
947247651 2:228067576-228067598 GAGTGAATTTGATTCCAATCAGG + Intronic
948034446 2:234846923-234846945 AAGTGCTGGTGACTGTAATCAGG - Intergenic
948155786 2:235779785-235779807 AAGTGAATGTGATAGGAAACTGG + Intronic
948243191 2:236455814-236455836 ATGTGCATTTGCTGGCAATCTGG + Intronic
1170942099 20:20856567-20856589 AAGTGGATGTGAGTGAGATCTGG + Intergenic
1175119941 20:56709688-56709710 GAATGCATGTGATTGCAGTTAGG + Intergenic
1177947643 21:27491982-27492004 AAGTACGTGTGCTTGCAATAAGG - Intergenic
1178596942 21:33962840-33962862 AATTGCAGGGGATTGCAACCTGG - Intergenic
1178709971 21:34908148-34908170 TAATTTATGTGATTGCAATCAGG - Intronic
1182275999 22:29189056-29189078 AAGTGCAAATGATTGCAGTTGGG + Intergenic
949155664 3:824696-824718 AAGTGCAAGTAAGTGCAATAAGG + Intergenic
949366072 3:3282222-3282244 GAGTGCATGTTATTCCAGTCTGG - Intergenic
951014646 3:17716971-17716993 AAGTCCATGTTATTGAAGTCAGG - Intronic
951695650 3:25443268-25443290 AAGTGCATTTGCTGGCAAACTGG + Intronic
953240993 3:41149429-41149451 AAGATCATTTGATTGCAATGTGG + Intergenic
953393536 3:42548485-42548507 AAGGGCATGTCAGTGAAATCTGG - Intronic
954237560 3:49268448-49268470 AAATGCATGTAATTGCACTTTGG - Intergenic
956763709 3:72466117-72466139 GAGGGCATGTGAATGCATTCTGG - Intergenic
958054100 3:88387145-88387167 AAAAGCATGTGTTTGCAGTCAGG - Intergenic
958986631 3:100787303-100787325 AACTGCATCTGTTAGCAATCTGG - Intronic
959375767 3:105587199-105587221 AATAGCAAGGGATTGCAATCTGG + Intergenic
959578369 3:107959565-107959587 AAGTTCATGTGTTGGCAATTTGG - Intergenic
964920958 3:161894956-161894978 AAGTACAGGTGATTTCAGTCTGG + Intergenic
965419509 3:168439820-168439842 AAGTGCATGTAAATCCTATCTGG + Intergenic
966278140 3:178200023-178200045 AAGTAGATGTGATAGCAATGAGG - Intergenic
975071961 4:70152360-70152382 AAGTCCATCTGACTGAAATCTGG - Intronic
976725484 4:88211917-88211939 AAATGCTTTTGACTGCAATCAGG - Intronic
980638110 4:135536119-135536141 CACTGACTGTGATTGCAATCTGG - Intergenic
981360491 4:143840158-143840180 AAGTGCTTGTGGTCGCAATGGGG + Intergenic
982352171 4:154427977-154427999 AAGTGCATATGAAGGCAGTCTGG + Intronic
986795057 5:11201916-11201938 AAGTGGATGTGCTTATAATCTGG - Intronic
988306318 5:29498813-29498835 GTGTGCATGTGAGTGCATTCTGG - Intergenic
989134535 5:38140362-38140384 AATTGCATGTGCTTTCTATCTGG - Intergenic
989550156 5:42725750-42725772 GAGTGCTTGTGTTTGCATTCTGG - Intergenic
991143312 5:63272561-63272583 TAGTGCTTGTGATTGCATTATGG + Intergenic
991368272 5:65891697-65891719 AATTGCATGTAATTACCATCAGG + Intergenic
996248777 5:121300622-121300644 AAGAACATGTTATTGCAAACTGG - Intergenic
1000112439 5:158121848-158121870 CAGTGGATGTGATTGCATGCTGG + Intergenic
1000143963 5:158434877-158434899 AGGTTCATGTCATTGCATTCTGG - Intergenic
1003602037 6:7526494-7526516 AAGATCATGTCATTGCACTCTGG + Intergenic
1006107904 6:31727865-31727887 AACTGCATGTGATTCCAAGGTGG - Intronic
1007375847 6:41456222-41456244 AATAGCAGGGGATTGCAATCTGG - Intergenic
1007837419 6:44684387-44684409 AAGTGCTTGTGCTTGCAAGATGG - Intergenic
1008756842 6:54806173-54806195 AAGTGCATGTGATAGGAATAAGG - Intergenic
1008842649 6:55922099-55922121 AAGTGCATGTGATGGAGATAGGG + Intergenic
1009395675 6:63196602-63196624 AAGATCATGTCATTGCACTCCGG + Intergenic
1010117325 6:72329507-72329529 AAGGGCATATGATTACTATCTGG - Intronic
1010298495 6:74229978-74230000 ATGTGCATGTGATTCAATTCTGG + Intergenic
1011912394 6:92457332-92457354 AACTACATGAGATTGGAATCTGG + Intergenic
1012776608 6:103502529-103502551 AAGTGCTAGTGAGAGCAATCAGG + Intergenic
1013284150 6:108666031-108666053 AAAAGCATTTGATTGAAATCAGG + Intronic
1019025108 6:168954717-168954739 AAGTGCTTGTAATAGAAATCAGG + Intergenic
1021026159 7:15669364-15669386 AAGTGTTAATGATTGCAATCAGG - Intronic
1024339955 7:48247267-48247289 AAGTGTATGTGAATGCATGCAGG + Intronic
1028677235 7:93479155-93479177 AAGTTCATCTGACTGCAATTTGG - Intronic
1028986018 7:97008636-97008658 AACTGCAGGTGATTGCAGCCTGG - Intronic
1030218753 7:107075149-107075171 AAGATCATGTCATTGCACTCCGG - Intronic
1030463328 7:109868293-109868315 AAGTGCATCTGATGGCACTCTGG - Intergenic
1031389651 7:121198481-121198503 AACTGCAGGTGCTTCCAATCAGG - Intronic
1032158339 7:129489432-129489454 AATAGCAGGGGATTGCAATCTGG + Intergenic
1034301467 7:150019160-150019182 AATTACATGTGAATGCATTCAGG - Intergenic
1034302756 7:150030931-150030953 AAGTCCATTTAATTGCAATGTGG + Intergenic
1034803304 7:154066381-154066403 AAGTCCATTTAATTGCAATGTGG - Intronic
1034804579 7:154078100-154078122 AATTACATGTGAATGCATTCAGG + Intronic
1038003557 8:23410844-23410866 AATTGCATATGTATGCAATCAGG + Intronic
1039138058 8:34349873-34349895 ATGTTCATGTGATTGATATCAGG + Intergenic
1039442692 8:37606153-37606175 AAGTGCGTGTGTTTGCTTTCCGG + Intergenic
1040576501 8:48656356-48656378 AATTACATGTGATTGCAATGTGG + Intergenic
1040724328 8:50363427-50363449 AACTGCTGGTCATTGCAATCAGG + Intronic
1042202508 8:66292908-66292930 AAGTGGATGTGATTGTAAGAGGG - Intergenic
1044773790 8:95666381-95666403 AATTGCAAGTGATTCCAATGAGG - Intergenic
1047305678 8:123651492-123651514 ATGTGCATGTGTGTGCAAGCAGG + Intronic
1049231138 8:141482527-141482549 AATTGCATGTAATTGGAAGCAGG + Intergenic
1051345126 9:16144520-16144542 AAGTGTATGTGTTTTCAAACAGG - Intergenic
1053359623 9:37475466-37475488 AAGAGCATGGCATTGGAATCTGG + Intergenic
1055030919 9:71770524-71770546 AAGTACATGTGACTGCAGTTAGG - Intronic
1056431408 9:86532037-86532059 AAGTGCATGTAATTGCCACATGG - Intergenic
1058653970 9:107203049-107203071 GAATGCATGTGATTGCATTTAGG - Intergenic
1058977648 9:110139321-110139343 ATGTGAATGTGATAGCAATCAGG + Intronic
1061871514 9:133523274-133523296 AAGTGCATGTGAGTGCACAGAGG - Intronic
1185520835 X:737616-737638 GAGTGCATGTGAGTGCATTGTGG + Intergenic
1185520845 X:737778-737800 GAGTGCATGTGAGTGCATTGTGG + Intergenic
1186216086 X:7302750-7302772 AAGTGGGTGTGAGTGCAACCTGG + Intronic
1186385969 X:9110477-9110499 AGGTGCATGTGAGTGCTGTCAGG - Intronic
1194172285 X:90601987-90602009 AAGTGCTTGTGGCTGCCATCAGG + Intergenic
1196805696 X:119583678-119583700 AAGTGAATGTGTTTGGAATATGG + Exonic
1197334980 X:125202777-125202799 GAGTGGATGTGTTTGCAGTCAGG - Intergenic
1201960045 Y:19670193-19670215 AAGTGCTGGTGAGAGCAATCAGG + Intergenic