ID: 1074524303

View in Genome Browser
Species Human (GRCh38)
Location 10:114250921-114250943
Sequence TGGGTTATACAGATGAGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074524295_1074524303 21 Left 1074524295 10:114250877-114250899 CCAGCCTCCAGATTGCAATCACA 0: 1
1: 0
2: 0
3: 15
4: 231
Right 1074524303 10:114250921-114250943 TGGGTTATACAGATGAGGCAGGG No data
1074524293_1074524303 27 Left 1074524293 10:114250871-114250893 CCCTGTCCAGCCTCCAGATTGCA 0: 1
1: 0
2: 3
3: 18
4: 374
Right 1074524303 10:114250921-114250943 TGGGTTATACAGATGAGGCAGGG No data
1074524294_1074524303 26 Left 1074524294 10:114250872-114250894 CCTGTCCAGCCTCCAGATTGCAA 0: 1
1: 0
2: 0
3: 14
4: 250
Right 1074524303 10:114250921-114250943 TGGGTTATACAGATGAGGCAGGG No data
1074524296_1074524303 17 Left 1074524296 10:114250881-114250903 CCTCCAGATTGCAATCACATGCA 0: 1
1: 0
2: 0
3: 7
4: 124
Right 1074524303 10:114250921-114250943 TGGGTTATACAGATGAGGCAGGG No data
1074524297_1074524303 14 Left 1074524297 10:114250884-114250906 CCAGATTGCAATCACATGCACTT 0: 1
1: 0
2: 0
3: 5
4: 143
Right 1074524303 10:114250921-114250943 TGGGTTATACAGATGAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074524303 Original CRISPR TGGGTTATACAGATGAGGCA GGG Intronic
No off target data available for this crispr