ID: 1074525335 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:114258121-114258143 |
Sequence | GCTGCAGAAGGGTTTGCATG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1074525328_1074525335 | 3 | Left | 1074525328 | 10:114258095-114258117 | CCAAGGTCAGGTGGACCCCTTGG | No data | ||
Right | 1074525335 | 10:114258121-114258143 | GCTGCAGAAGGGTTTGCATGAGG | No data | ||||
1074525327_1074525335 | 6 | Left | 1074525327 | 10:114258092-114258114 | CCTCCAAGGTCAGGTGGACCCCT | No data | ||
Right | 1074525335 | 10:114258121-114258143 | GCTGCAGAAGGGTTTGCATGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1074525335 | Original CRISPR | GCTGCAGAAGGGTTTGCATG AGG | Intronic | ||