ID: 1074525335

View in Genome Browser
Species Human (GRCh38)
Location 10:114258121-114258143
Sequence GCTGCAGAAGGGTTTGCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074525328_1074525335 3 Left 1074525328 10:114258095-114258117 CCAAGGTCAGGTGGACCCCTTGG No data
Right 1074525335 10:114258121-114258143 GCTGCAGAAGGGTTTGCATGAGG No data
1074525327_1074525335 6 Left 1074525327 10:114258092-114258114 CCTCCAAGGTCAGGTGGACCCCT No data
Right 1074525335 10:114258121-114258143 GCTGCAGAAGGGTTTGCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074525335 Original CRISPR GCTGCAGAAGGGTTTGCATG AGG Intronic