ID: 1074529583

View in Genome Browser
Species Human (GRCh38)
Location 10:114288128-114288150
Sequence GGGGATGCAGAGAGGCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 534
Summary {0: 1, 1: 2, 2: 5, 3: 48, 4: 478}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074529583_1074529587 -10 Left 1074529583 10:114288128-114288150 CCCACAGGCCTCTCTGCATCCCC 0: 1
1: 2
2: 5
3: 48
4: 478
Right 1074529587 10:114288141-114288163 CTGCATCCCCTGCACAGGAGAGG No data
1074529583_1074529593 28 Left 1074529583 10:114288128-114288150 CCCACAGGCCTCTCTGCATCCCC 0: 1
1: 2
2: 5
3: 48
4: 478
Right 1074529593 10:114288179-114288201 TTACTTGTCTTTCAGTTCTTAGG No data
1074529583_1074529591 -2 Left 1074529583 10:114288128-114288150 CCCACAGGCCTCTCTGCATCCCC 0: 1
1: 2
2: 5
3: 48
4: 478
Right 1074529591 10:114288149-114288171 CCTGCACAGGAGAGGCCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074529583 Original CRISPR GGGGATGCAGAGAGGCCTGT GGG (reversed) Intronic
900487727 1:2931367-2931389 GGGGAAGCAGAGAGGCCCGCAGG + Intergenic
900489243 1:2938687-2938709 GGGGCTGCGGAGAGGCCTTATGG + Intergenic
900536262 1:3179240-3179262 GGTGAGGCAGAGAGGCCAGCAGG + Intronic
900970850 1:5991906-5991928 GGGGCTGCAGAGAGGCCAGGGGG + Intronic
901703775 1:11059240-11059262 GTGGCTGCAGAGAGGCAGGTTGG + Exonic
903045847 1:20563608-20563630 GGGGATGCAGAGAGGGGAGGGGG + Intergenic
903182273 1:21610911-21610933 GGGAAGGCAGATAGCCCTGTAGG + Intronic
903217774 1:21852647-21852669 GAGGAGGCAGAGAGGCCTCCGGG - Intronic
903564551 1:24254941-24254963 GGTGATACAGAGAGGCATGCTGG + Intergenic
903835039 1:26198156-26198178 GGAAAAGCAGAGAGGCCTGTGGG + Intronic
903872631 1:26447631-26447653 GGGGGTGGAGCAAGGCCTGTTGG + Exonic
903973703 1:27136012-27136034 TGGGATTCAGACAGGTCTGTTGG + Intronic
904282682 1:29432449-29432471 GGATATGCACAGAGGGCTGTGGG - Intergenic
904358813 1:29959452-29959474 GGGGATGCCGAGGGGCCAGAGGG - Intergenic
904827373 1:33282157-33282179 GGACATGCACAGAGCCCTGTGGG - Intronic
905791662 1:40792737-40792759 GGGGATGCACAGAGGCTAGGTGG + Intronic
906539119 1:46571476-46571498 GGGGCTGCAGTGAGCCCTGATGG + Exonic
906676394 1:47696747-47696769 GGAGATGCAGAGGGGTCTGCGGG + Intergenic
907710786 1:56878740-56878762 GGGAAGGGAGAGAGGGCTGTTGG - Intronic
908472644 1:64459128-64459150 GGGGACAGAGAGATGCCTGTAGG + Intergenic
911661250 1:100503962-100503984 TGGGATGTAGAGAGGCTTATGGG - Intronic
912350130 1:109004683-109004705 GTTGATGCACAGAGGCCTATCGG - Exonic
913107219 1:115625537-115625559 GGGCCTGCAGAGAAGCCTGGCGG + Intergenic
913228383 1:116720564-116720586 GGGGAGGCAGACAGGCCTGTGGG - Intergenic
913519870 1:119634711-119634733 GGGAAAGTAGAGAGACCTGTAGG + Intronic
913531702 1:119738325-119738347 GAGGGGGCAGAGAGGCCTGGAGG - Intronic
915098665 1:153483025-153483047 GTGGATGAAGAGAAGACTGTTGG - Intergenic
915101199 1:153502022-153502044 TGGGTTGCAGAGAGCCCTTTTGG + Intergenic
915442049 1:155951383-155951405 GGGTATTTAGAAAGGCCTGTTGG + Intronic
915726067 1:158018496-158018518 GGGAATGCAGTGTGGCCTGTAGG + Intronic
916297211 1:163232715-163232737 GTGGAGGCAGACATGCCTGTGGG + Intronic
916655119 1:166868487-166868509 GGAGATGAAGAGAGGGCAGTTGG - Intronic
916823759 1:168425335-168425357 TGCGGGGCAGAGAGGCCTGTTGG + Intergenic
916860995 1:168805376-168805398 TAGGATTCAGAGAGGCCTTTGGG - Intergenic
917298616 1:173549308-173549330 GGGGATTCAGAAAGATCTGTAGG + Intronic
917449412 1:175134598-175134620 GGGGATTCAGAGAGGACAGGTGG - Intronic
918617411 1:186561894-186561916 GGGGATGGAGAGAGGCAAGCAGG + Intergenic
919911462 1:202113459-202113481 GAGGATGCAGGGTGCCCTGTGGG + Intergenic
920500897 1:206484921-206484943 TGGGAGGCAGAGAGCTCTGTTGG - Intronic
921066807 1:211629102-211629124 GGGGATGCAGAGGGGGCCATAGG - Intergenic
921085205 1:211784424-211784446 GAGGATGCAGTGAGCCCTGATGG + Intronic
922037688 1:221865521-221865543 GGGCATCAAGAGAGGCCTCTGGG - Intergenic
922195739 1:223359073-223359095 GGGTATGCAGAGAGGGCCGCTGG + Intronic
922465822 1:225845162-225845184 GGGAAGGCAGAGAAGCCAGTGGG - Exonic
923086405 1:230706324-230706346 GAGAATGCAGAGTGGCCTGGGGG - Intronic
923453557 1:234142491-234142513 CGGGGTGCAGAGCAGCCTGTTGG + Intronic
924071546 1:240285386-240285408 GGTGATGCTGAGAAGGCTGTTGG + Intronic
1063119134 10:3092395-3092417 GGGGATGCAGAGAGGTGGATGGG + Intronic
1065666932 10:28072948-28072970 GGGTATGGAGAGAGGCCATTGGG - Intronic
1066070778 10:31808586-31808608 GGGGAAGCGGGAAGGCCTGTGGG - Intronic
1067082890 10:43221584-43221606 GGGGAGCCAGCCAGGCCTGTGGG + Intronic
1067565064 10:47330545-47330567 GGGGATGCAGAGAGGCTGCCAGG + Intergenic
1067565343 10:47332098-47332120 GGGGAGGCAGGCAGGGCTGTTGG - Intergenic
1069739704 10:70679604-70679626 GGGGAGGCAGAGATGGCCGTAGG - Intronic
1070313355 10:75289318-75289340 GGACATGCCCAGAGGCCTGTGGG - Intergenic
1070675931 10:78411199-78411221 AGGGTTCCAGTGAGGCCTGTGGG - Intergenic
1070730308 10:78823027-78823049 CGGGATCCAGAGAGGCCTGAAGG - Intergenic
1070733281 10:78846332-78846354 GGGGAGGCAGTGTGGCCTGAGGG + Intergenic
1070815207 10:79318512-79318534 GTGGATGGAGATAGGTCTGTGGG - Intergenic
1071463735 10:85921463-85921485 GGGCCTGCAGAATGGCCTGTTGG - Intronic
1071573122 10:86708788-86708810 GTGGATCCAGAGAGGTCTGAGGG - Intronic
1072324827 10:94287794-94287816 GGGGATGCAGGGGAGCTTGTGGG - Intronic
1073006545 10:100329626-100329648 GGGGATCCAGAGAGGTATGTGGG - Intronic
1073431859 10:103492364-103492386 GGGGATGGAGAGAGGAGAGTAGG + Intergenic
1074524229 10:114250503-114250525 GGGGTTGCACAGTGGCCTCTGGG + Intronic
1074529583 10:114288128-114288150 GGGGATGCAGAGAGGCCTGTGGG - Intronic
1075060864 10:119255864-119255886 TGGGATGCAGGGAGGGCTCTGGG + Intronic
1075441958 10:122487006-122487028 GGGCAGGCACACAGGCCTGTTGG + Intronic
1076126191 10:127975971-127975993 GAGGATGCAGTGATCCCTGTTGG + Intronic
1076294346 10:129373011-129373033 GGGGATGCAGTGAGGCATCATGG + Intergenic
1076622577 10:131801702-131801724 GTGGATACAGAGAGGCCTATGGG - Intergenic
1076796655 10:132801623-132801645 GGGGATGCAGACACCCCTGCCGG + Intergenic
1077430171 11:2512402-2512424 GGGGATTCAGAGAGGGAGGTAGG - Intronic
1078454648 11:11465577-11465599 CGGGAACCAGAGAGGCCTGGAGG + Intronic
1079987824 11:27216779-27216801 GGGGAGGCAGAGCTGCCTGCAGG - Intergenic
1080770560 11:35337198-35337220 ATGGATACAGAGAGGCCTGTGGG - Intronic
1080815517 11:35752643-35752665 GGGGATGGAGAGAGGTAGGTGGG - Intronic
1083176504 11:60953079-60953101 GGGGATGCTGAGAATCCAGTAGG - Intergenic
1083300567 11:61737805-61737827 GGGGGTGGGGAGAGGCCTGGAGG - Intronic
1083464241 11:62834575-62834597 GAGGATGCAGAGACGCCAGAGGG - Intronic
1083476966 11:62921221-62921243 GGGGCTGAAGAGGGGTCTGTAGG + Exonic
1083597379 11:63924647-63924669 GAGGAGGCAGAGAGTCCAGTGGG - Intergenic
1083969346 11:66063964-66063986 GGGGTGGCAGGGAGGCCTTTGGG + Intronic
1084010682 11:66346822-66346844 GGGGCTGTGGAGAGGCCTGCGGG - Exonic
1084475605 11:69386972-69386994 GGGGTTGAAGGGAGGCCTGGAGG - Intergenic
1084680558 11:70663939-70663961 GGTGATCCCAAGAGGCCTGTAGG - Intronic
1085272317 11:75277641-75277663 GGGGATTCGGAGAAGCCTCTTGG - Intronic
1085297286 11:75438341-75438363 GGGGATCAGGAGAGGCCTGGTGG - Intronic
1085472902 11:76769421-76769443 GGGGGTGGCGGGAGGCCTGTGGG - Intergenic
1085625032 11:78065253-78065275 GAGTATGCAGACATGCCTGTTGG + Intronic
1086663614 11:89452777-89452799 GGGGCTGCAGTGAGCCCTGATGG - Intronic
1089350526 11:117819365-117819387 GGCCATGCAGGGAGGCCTCTGGG - Intronic
1089391189 11:118103061-118103083 GGAGAGGCAGAGAGGGCTGAGGG - Intronic
1089710759 11:120312897-120312919 GGGGGTGCAGAGAGGTGTGAGGG + Intronic
1090204570 11:124877347-124877369 GCGGAAGAAGAGTGGCCTGTCGG - Intronic
1091075199 11:132608999-132609021 GGGGAGGCAGAGAGACCAGTTGG - Intronic
1091657164 12:2354112-2354134 GGGGATGGAGTGGGGGCTGTCGG + Intronic
1091663337 12:2400655-2400677 AGGGAGGCAGAGAGTGCTGTGGG - Intronic
1091690489 12:2593227-2593249 GAGGAGCCAGAGATGCCTGTCGG + Exonic
1092452336 12:8614552-8614574 GGGGAGGCAGGAAGGCCAGTTGG - Intergenic
1092997408 12:13963208-13963230 GGCGATCCAGAGAGACCTGGGGG - Intronic
1093474518 12:19539813-19539835 GTGGATACAAGGAGGCCTGTGGG + Intronic
1094375331 12:29783458-29783480 GAGGACGCAGAGCGGCCGGTAGG + Exonic
1094411133 12:30169890-30169912 GAGGGTGCAGAGTGGCCGGTGGG + Intergenic
1095486447 12:42689701-42689723 GAGGATGCACAGAGGCCAGGAGG + Intergenic
1096194062 12:49637627-49637649 GGGGGTGCAGAGAGGCTGGCAGG - Exonic
1096956760 12:55534342-55534364 GGGGATGCAGTGAGCTCCGTGGG - Intergenic
1097031429 12:56092959-56092981 GGGGTTGGAGAGAGGCATATGGG - Intronic
1097167437 12:57093313-57093335 GGGGGGGCAGAAGGGCCTGTGGG + Intronic
1097185438 12:57194096-57194118 GGGAAGGCAGAGAGGAATGTGGG - Intronic
1101753148 12:107599893-107599915 GGGGATCCAAAGAGGCCAATAGG - Intronic
1101865587 12:108517439-108517461 GGGGAAGCATAAAGGGCTGTAGG + Intronic
1102083629 12:110118300-110118322 GGGGATCCGGAGAGGTCTGCTGG + Intergenic
1102942864 12:116959357-116959379 GAGGAGGCAGAGTGGCTTGTTGG + Intronic
1103052319 12:117790911-117790933 GGGGAGTCAGAGAGACCAGTTGG - Intronic
1103700274 12:122845616-122845638 GGGGAAGCAGATCGGCCTATAGG - Intronic
1104274963 12:127318304-127318326 GGGGATGCAGTGAGGATGGTGGG - Intergenic
1104383810 12:128331163-128331185 GGGGATGGAGGGAGGACTGTTGG - Intronic
1104924408 12:132306414-132306436 AGCCATGCAGAGAGGCCTGTTGG + Intronic
1104975517 12:132550295-132550317 GGGAGAGCAGAGAGGCCTGGCGG + Intronic
1105022557 12:132827086-132827108 GGGGAAGCAGAAAGTCCTGTAGG - Intronic
1105327937 13:19387240-19387262 TGGGTTGCAGACAGGCCAGTAGG + Intergenic
1105951941 13:25236809-25236831 AGAGAAACAGAGAGGCCTGTGGG - Intergenic
1107937446 13:45357063-45357085 GGGCATGGAGAGAGGCATGCTGG + Intergenic
1111443692 13:88316127-88316149 GGGGCCACAGAGGGGCCTGTAGG - Intergenic
1111997108 13:95175973-95175995 CGGGAAGGAGTGAGGCCTGTGGG - Intronic
1112004977 13:95246028-95246050 GGAGATGCAGAGGGTCCTGCTGG - Intronic
1112128483 13:96496246-96496268 GGGGATGGAGTGAGGAATGTGGG + Intronic
1113644145 13:111980454-111980476 GGGGAGGCAGGGAGGGCTCTGGG - Intergenic
1113645986 13:111996335-111996357 GGGAATGGAGAGAGTCCTGTGGG - Intergenic
1113675391 13:112203199-112203221 GGGATCGCAGAGAGGCCTCTGGG + Intergenic
1114243535 14:20891588-20891610 GTGGCAGCAGAGGGGCCTGTGGG + Intronic
1114250471 14:20955673-20955695 GTGGCCGCAGAGGGGCCTGTGGG + Intronic
1117332133 14:54723483-54723505 GAGGATTCAGAGAGGCATCTTGG + Intronic
1118357676 14:65028230-65028252 GGAGGTGCAGAGAGCCTTGTGGG + Intronic
1118454066 14:65929425-65929447 GGGGAGGCTGAGAGCCCTGGGGG + Intergenic
1118589571 14:67391412-67391434 GGGGAGGAAGAGAGGCCCCTAGG - Intronic
1118930139 14:70234090-70234112 GGGGTTGCCGCGAGGCCTCTGGG + Intergenic
1121124444 14:91397118-91397140 GGGGAGGGAGAGGGGCCTGGGGG + Intronic
1121257772 14:92543879-92543901 GAGCATGCAGAGATACCTGTTGG - Intronic
1121784119 14:96642253-96642275 GGGGATGAAGAGAGGAGAGTTGG - Intergenic
1122199520 14:100114013-100114035 GCGGAGGCAGAGAGGCCAGTTGG + Intronic
1122370445 14:101226377-101226399 GGGGGTGCAGAGAGGCCAGGGGG + Intergenic
1122401308 14:101469150-101469172 GGGGATCCAGAAAGGACTGGTGG + Intergenic
1122416035 14:101549884-101549906 GGGGATGTAGAGGGTTCTGTGGG - Intergenic
1122718986 14:103711832-103711854 GGGGATGCAGAGTGGCCTGTTGG - Exonic
1122775105 14:104113565-104113587 GGGCAGGTAGAGAGGCCTGGAGG - Exonic
1122784491 14:104157563-104157585 GGGCTGGCAGAGAGGCCAGTGGG - Intronic
1122855757 14:104559416-104559438 GGGGATGGAGGGAGGCCGGGTGG - Intronic
1122902291 14:104786892-104786914 GAGAATGCAGAGAGGCCCTTCGG - Intronic
1122930902 14:104932705-104932727 CGGGCTGCAGAGGGGCCTGTGGG + Intronic
1124063660 15:26319625-26319647 GGGGATGCAGAGAGGCAAGAGGG + Intergenic
1124708482 15:31985129-31985151 AAAGATGCAGAGGGGCCTGTGGG - Intergenic
1124966243 15:34435210-34435232 GTGGCTGCAGTGAGGGCTGTTGG - Intronic
1124982845 15:34581293-34581315 GTGGCTGCAGTGAGGGCTGTTGG - Intronic
1125472931 15:40022079-40022101 GAGGGGGCAGAGAAGCCTGTGGG - Intronic
1126379316 15:48029637-48029659 AGGGATGCAGTGGGGCCTCTGGG + Intergenic
1126698084 15:51342149-51342171 GGTGCTGCGGAGAGGGCTGTGGG + Intronic
1127043717 15:55004115-55004137 GGGGTTGGAGAGAGGCCAGTTGG - Intergenic
1127206451 15:56725060-56725082 GGGGCTTGAGAGAGGCCTGGGGG - Intronic
1127502671 15:59569404-59569426 GGGGATGCCACGAGGCCTGCTGG + Intergenic
1128401819 15:67290889-67290911 GGGAATGCAGAGAGACTTCTGGG + Intronic
1128467889 15:67928150-67928172 GGGGCTGCCGAGAGGGCTGGGGG + Intergenic
1128532702 15:68465392-68465414 GGGGATGCAGTGAGTCCTGCTGG - Intergenic
1129169705 15:73800118-73800140 GGAGTTGCAGAGAGGACTGGAGG - Intergenic
1129206359 15:74039152-74039174 GCGGAGGAAGGGAGGCCTGTGGG + Intronic
1129562845 15:76589831-76589853 GGGGATGCAGAGAGCCCACAGGG + Intronic
1129665330 15:77576374-77576396 GGGGAGGAGGACAGGCCTGTAGG + Intergenic
1129974796 15:79813156-79813178 GGGGATCCAAAGAGCCCTGCGGG + Intergenic
1131654393 15:94440653-94440675 GGGCATGCAGAGAGCTCTGCAGG + Intronic
1132000504 15:98174616-98174638 GGGGAGTCAGAGAGGCTTCTTGG - Intergenic
1132381861 15:101371705-101371727 GCGGAGGCAGTGAGGCCTGGAGG - Intronic
1132519009 16:378899-378921 GGGGATGGAGAAGGGCCCGTGGG + Intronic
1132766755 16:1538229-1538251 GAGGCTGCAGAGTGGCTTGTGGG + Intronic
1132941534 16:2510913-2510935 GAGCATCCAGAGAGGCCTGAAGG + Intronic
1135055920 16:19232037-19232059 GGGGATGCAGAGAGGTCGGCCGG + Intronic
1135388906 16:22071650-22071672 TGAGATGCTGAGAGGCATGTGGG + Intronic
1135520436 16:23172776-23172798 GGGGAAGCAGTGGGGCCTGTGGG + Intergenic
1136463861 16:30428909-30428931 TGGGATGCAGAGAGGACTCACGG - Intronic
1138455186 16:57116900-57116922 GGGGAGGGAGAGAGGCCTACAGG + Intronic
1138651159 16:58462654-58462676 GGGGGTGCAGAGGGGCCTGCAGG - Intergenic
1139634384 16:68249039-68249061 TGTGGTGCAGAGATGCCTGTGGG - Intronic
1139649641 16:68355884-68355906 GTGGGTGCAGAGAGGGCTGGGGG + Intronic
1141602207 16:85133754-85133776 GGGGGTGCAGAGAGGGAGGTGGG + Intergenic
1142043222 16:87908747-87908769 AAGGATGAAGAGATGCCTGTGGG - Intronic
1142108727 16:88319758-88319780 TGGGCTGCAGGGAGGCCTGGGGG - Intergenic
1142114864 16:88351346-88351368 AGGCCTGCACAGAGGCCTGTGGG - Intergenic
1142197882 16:88747029-88747051 AGGGGTGCAGAGAGGCATTTTGG - Intronic
1142359585 16:89619811-89619833 GGGGCTGCAGAGAGGGGAGTGGG - Intronic
1142530511 17:576575-576597 GGGAATGCATTGAGGTCTGTGGG - Intronic
1143109262 17:4544295-4544317 GGGGATGAAGCAAGGACTGTGGG + Intronic
1143262959 17:5614020-5614042 GGGGACTCAGAGAAGCCTGAGGG - Intronic
1143331221 17:6137300-6137322 GGGGATTCAGAGAGGCCACGTGG + Intergenic
1143556949 17:7667963-7667985 CTGGATGGAGAGAGGCCAGTGGG - Intronic
1144339088 17:14297938-14297960 GGGGTCGCACAGAGGGCTGTTGG + Intergenic
1144573902 17:16417101-16417123 GGAGAGGGAGGGAGGCCTGTGGG - Intronic
1145066002 17:19761898-19761920 GGGGAGGCTGAGAAGCCTATAGG - Intergenic
1145240891 17:21240666-21240688 GGGGATGCTCAGGGGCCTGCAGG - Exonic
1145261784 17:21358846-21358868 GGGGCAGCAGGGAGGCCTGCAGG + Intergenic
1146658081 17:34646883-34646905 GTGGATGGAGAGAGGCCTGTCGG + Intergenic
1146890510 17:36503579-36503601 GGGGAGGCAGAGGAGACTGTGGG - Intronic
1147285937 17:39402336-39402358 GGTGCTGCAGGGAGGCCTGGGGG + Intronic
1147336574 17:39730016-39730038 GGGGTGTCACAGAGGCCTGTGGG - Intronic
1147356954 17:39905787-39905809 GTGTGAGCAGAGAGGCCTGTGGG - Intronic
1148209138 17:45797741-45797763 GGGGCTGGAGAGATGCTTGTTGG - Intronic
1148444384 17:47728639-47728661 GCAGAGGCAGAGAGGCCTGGGGG - Intergenic
1148792331 17:50180375-50180397 GGGGGAGCAGAGAGGAGTGTGGG - Intergenic
1151599130 17:75095371-75095393 GGAGATGCTGAGATGCCTGCTGG - Intronic
1151661144 17:75518893-75518915 GGAGGGGCAGAGAGGGCTGTGGG + Intronic
1151906728 17:77053880-77053902 GGGGACTCAGGGAGGCCTGTGGG + Intergenic
1152418451 17:80178211-80178233 GGAGCCGCAGACAGGCCTGTGGG + Intronic
1152612674 17:81323301-81323323 GTGGACGCAGAGGGGGCTGTTGG + Intronic
1152615938 17:81337766-81337788 GGGGATGCAGGGGCGCCTGGGGG + Intergenic
1153997366 18:10454330-10454352 AGGGAGGCAGAGGGGCCTGGAGG + Intergenic
1154384382 18:13880161-13880183 GGGACTGCAGAGGGGCCTCTAGG - Intergenic
1154502116 18:15002249-15002271 GGGGCTGGGGAGAGGCCAGTGGG - Intergenic
1155151492 18:23126792-23126814 TGGGAGACAGAGAGCCCTGTAGG + Intergenic
1155997330 18:32343938-32343960 AGGGAGTCAGAGAGGCTTGTGGG - Intronic
1157556561 18:48616487-48616509 GGGGATGGAGAGAAGGCAGTTGG + Intronic
1157575364 18:48739710-48739732 CTGGAAGCTGAGAGGCCTGTGGG + Intronic
1157716474 18:49891321-49891343 GGGGATGGAGGGTGACCTGTGGG - Intronic
1160204218 18:76820394-76820416 GGGGAGGCAGAGAGTGCAGTAGG + Intronic
1160251042 18:77203684-77203706 GGTGGTGCAGACCGGCCTGTCGG + Intergenic
1160591048 18:79944915-79944937 GGGGGTGCTGAGGGGGCTGTGGG - Intronic
1160591063 18:79944968-79944990 GGGGGTGCTGAGGGGGCTGTGGG - Intronic
1162054104 19:8052594-8052616 GGGGAGGCAAGGGGGCCTGTGGG + Intronic
1162524157 19:11197670-11197692 GGGGATGGAGAGACGCTGGTTGG + Intronic
1162949132 19:14060362-14060384 GGGGAGGCAGAGGTGGCTGTGGG - Intergenic
1163298734 19:16429810-16429832 GTGGAGCCAGAAAGGCCTGTTGG - Intronic
1163442528 19:17328997-17329019 GGGGAAGGAGAGAGGCGCGTGGG + Intronic
1163514563 19:17755216-17755238 GGGGATGCTGGCAGGGCTGTGGG + Intronic
1163816158 19:19465717-19465739 GGGGTTGTGGAGAGGGCTGTAGG + Intronic
1164161282 19:22627143-22627165 GGGGATGCAGAGAGCCCAGCAGG - Intergenic
1164609247 19:29621089-29621111 GTGGATGCAGGGAGGCCAGCGGG - Intergenic
1164672099 19:30078035-30078057 GGGGAACCAGAGAGCCCTCTCGG + Intergenic
1165350591 19:35272990-35273012 GGGGATGCAGTGAGTCTTGGTGG + Intronic
1165391202 19:35539970-35539992 GGGGATGGAGAGGGGGCTGGAGG - Intronic
1165856386 19:38881195-38881217 GGGGAGGCAGAGAGGACAGGTGG + Intronic
1166069012 19:40376986-40377008 GGGGGTGCAGAGAGAGGTGTTGG + Intronic
1166354262 19:42217607-42217629 GAGGATCCAGAGAGGCCTAATGG - Intronic
1167666046 19:50823313-50823335 GGGGATGATCAGAGTCCTGTGGG + Intronic
1167824683 19:51961452-51961474 GAGCATGCACAGAGGCCTGAAGG + Intergenic
1168617424 19:57849970-57849992 GGGGCTGCAGAGCCGCCTCTGGG - Exonic
1168625737 19:57916458-57916480 GGGGCTGCAGAGCCGCCTCTGGG + Exonic
925043090 2:748876-748898 GTGTCTGCATAGAGGCCTGTGGG + Intergenic
925043098 2:748951-748973 GTGTCTGCATAGAGGCCTGTGGG + Intergenic
925170030 2:1744591-1744613 GGGGATTCAGAGGGGCCGGGAGG - Intronic
925290125 2:2742261-2742283 GAGGATGCAGAGAAGACTGATGG + Intergenic
925315450 2:2919411-2919433 GGGGATGCAGGGATGGATGTTGG - Intergenic
925333831 2:3078563-3078585 GGGGGGGCAGAAAGGCCTGGGGG - Intergenic
925628819 2:5868364-5868386 GGGGAGGCATGGAGCCCTGTAGG + Intergenic
926202985 2:10814484-10814506 GGGAAAGCAGACAGGCCTGGAGG - Intronic
926295830 2:11567860-11567882 GGGGATACACAGGGACCTGTGGG - Intronic
926739782 2:16101780-16101802 GGTGAGGCAGAGAGACCTGCGGG - Intergenic
927474776 2:23404614-23404636 AGGGAAGCTGAGAGGCCTGGGGG + Intronic
928087047 2:28352462-28352484 GGGGGTGCAGACAGGCCAGCAGG + Intergenic
929681689 2:43998267-43998289 GGGGGTGGAGAGGGGCCTGGAGG + Intergenic
929873323 2:45775884-45775906 AGGGATGCAAGGAGGCCAGTGGG - Intronic
934866269 2:97815754-97815776 GGCAATGCAGAGAGGCATTTTGG - Intronic
935080061 2:99784076-99784098 GGGAATGCAGACTGGCCTCTCGG - Intronic
935080592 2:99789575-99789597 GGGGATGCAGAGAGGCCTGGTGG - Intronic
935216301 2:100977703-100977725 GGGAAGGCAGAGGGGCCTGTGGG - Exonic
935217872 2:100988856-100988878 GGAGGAGCAGAGAGGCCTGGAGG - Intronic
935326776 2:101944784-101944806 AGGGAAGCAGAGAGACCTGGAGG - Intergenic
935674110 2:105579721-105579743 AGGGAGGAGGAGAGGCCTGTGGG - Intergenic
936993008 2:118386100-118386122 GGGGATGAAGAGAGGGAGGTAGG + Intergenic
937047816 2:118861385-118861407 GGGGAAGCAGAGAGGATTGATGG + Intergenic
938240790 2:129741083-129741105 GGGGCTGCAGAGACTCATGTTGG - Intergenic
938501294 2:131832421-131832443 GGGGCTGGGGAGAGGCCAGTGGG - Intergenic
941068366 2:160928623-160928645 GTCTATGCAGAGATGCCTGTGGG - Intergenic
941539250 2:166761687-166761709 GCAGATGGAGAGAGTCCTGTGGG - Intergenic
941982824 2:171478172-171478194 GGGGTTGCAGGCAGGCCAGTTGG + Intronic
942939709 2:181601708-181601730 GTGGACTCAGGGAGGCCTGTAGG - Intronic
946175965 2:217922200-217922222 GGGTAAGCAGAGAGCCCTGCAGG - Intronic
946189767 2:218002150-218002172 GGGCCAGCAGAGAGGCCTGGGGG - Intronic
946226101 2:218264894-218264916 AGGAATGCAGAGAAGCCTGAGGG - Intronic
946307718 2:218865673-218865695 GGGGAGCAGGAGAGGCCTGTGGG - Intronic
948088068 2:235267221-235267243 GGAGATGCAGGGGGGTCTGTGGG - Intergenic
948231200 2:236350842-236350864 GGGGAAGCTGAGGGGCCTGCTGG + Intronic
948533837 2:238631689-238631711 GGGGAGGCAGAGATGGCAGTGGG - Intergenic
948908040 2:240989156-240989178 GGGAGGTCAGAGAGGCCTGTGGG + Intronic
1168897227 20:1331967-1331989 GAGGATCCGGAGAGGCCTCTGGG - Intronic
1169272030 20:4207890-4207912 GAGGATGCAGTGAGCCATGTTGG + Intergenic
1169422995 20:5474614-5474636 GAGGATGGAGCCAGGCCTGTCGG - Intergenic
1169426432 20:5500861-5500883 GAGGATGGAGCCAGGCCTGTCGG + Intergenic
1169932864 20:10853001-10853023 GGCGAGGCAGAGAGCCCAGTTGG + Intergenic
1170174978 20:13459050-13459072 GGTGATGGAGAGTGGCCTCTAGG - Intronic
1170289161 20:14748160-14748182 GGGCATGCTAAGAGGCGTGTAGG - Intronic
1170434723 20:16314761-16314783 GTGGATGCAGAGAGGCCACAAGG - Intronic
1170573046 20:17643093-17643115 GGGGAGGTAGAGAGGGCCGTCGG + Exonic
1170809022 20:19659101-19659123 GGGGAAGCAGATAGGCCTATGGG + Intronic
1171367834 20:24638417-24638439 GAGGATGCAGTGAGTCCTGATGG - Intronic
1171987553 20:31671054-31671076 GAGGATGCAGACAGGCCCTTGGG - Intronic
1172612999 20:36265735-36265757 GGTGATGGACAGAGTCCTGTGGG - Intronic
1173895775 20:46549712-46549734 TGAGATGCAGTGAGGCCTGTGGG + Intronic
1174062516 20:47842879-47842901 GTGGAAGAAGGGAGGCCTGTCGG - Intergenic
1174073117 20:47912619-47912641 GTGGAAGAAGGGAGGCCTGTCGG + Intergenic
1174203452 20:48823242-48823264 GGGTGGGCAGAGAGGCCGGTGGG - Intronic
1174460418 20:50678413-50678435 TGGCATGCAAACAGGCCTGTGGG - Intronic
1175161357 20:57010064-57010086 GGGGAGGCAGGCAGGCATGTGGG - Intergenic
1175665395 20:60854352-60854374 GGGGATAGAGAGAAGCCAGTAGG + Intergenic
1175891315 20:62317284-62317306 GGGGATGCAGACAGGGCCTTGGG - Intronic
1177812330 21:25937832-25937854 GAGGTTGCAGTGAGGCCTGGCGG - Intronic
1178427546 21:32491215-32491237 GGGGCTGCAGTGAGACCTGCAGG + Intronic
1178876000 21:36414268-36414290 GGGGATGCAGAGGGGAGTGGTGG + Intronic
1179632366 21:42686431-42686453 GTGGAGGCAGAGAGGCCCGGAGG - Intronic
1180172594 21:46067559-46067581 GGGGAAGCAGAGAGTTCGGTGGG + Intergenic
1180246673 21:46553053-46553075 GGGGATGCAGATAAGGCTGGGGG + Intronic
1181039298 22:20184368-20184390 TGGGGTGCACAGGGGCCTGTGGG - Intergenic
1181523064 22:23460295-23460317 GGGGAGAGGGAGAGGCCTGTCGG + Intergenic
1181783393 22:25208693-25208715 AGGGATGCAGAGAGACCAGTTGG + Intergenic
1181854747 22:25773923-25773945 GTGGAGGCAGGGAGGCCTGTCGG + Intronic
1182084169 22:27550158-27550180 CGGGAGGCAGGGAGGCCAGTGGG + Intergenic
1182426942 22:30278565-30278587 GGAGAGGCAGGGAGGCCTGAGGG + Intergenic
1182438360 22:30345928-30345950 AAGGATGCAGTGTGGCCTGTGGG - Intronic
1182484111 22:30629078-30629100 GGTGATGCAGAGAGGCTTTACGG - Intergenic
1183422226 22:37718485-37718507 GGGGATGCTGAGCAGCCTCTTGG - Intronic
1184096835 22:42320720-42320742 GGAGCTCCAGGGAGGCCTGTGGG - Intronic
1184164622 22:42720322-42720344 GGGGATGGAGAGCGGCCGGCAGG - Intronic
1184235072 22:43179031-43179053 GGGGAGGAAGAGGAGCCTGTGGG - Intronic
1184248155 22:43246004-43246026 GGGGCTGCAGGGAGGCCTGAGGG + Intronic
1184308929 22:43628579-43628601 GGGGGTGTAGACAGGCTTGTGGG - Intronic
1184406686 22:44304543-44304565 GTGGGAGCAGAGAGGCCTGCGGG - Intronic
1184409465 22:44318144-44318166 GGGCCTGCAGAGAGGACTCTCGG - Intergenic
1184443567 22:44534151-44534173 GGGGCTGCAGAGAGGAATGAAGG + Intergenic
1184511984 22:44939306-44939328 GGAGAAGGAGAGAGGGCTGTGGG + Intronic
1184646147 22:45896513-45896535 GGGGCTGGAGAGGGGCCTCTGGG + Intergenic
1184763910 22:46561844-46561866 GAGGATGCAGGGAGGTCTGGGGG + Intergenic
1184766570 22:46575633-46575655 GGGGAGCCAGAGAGGTCTGGCGG + Intergenic
1184803662 22:46777617-46777639 GGGCATGCAGAGAGGCTGGCAGG + Intronic
1184924759 22:47629470-47629492 CGGGCTGCAGAGAGGCCTGCGGG - Intergenic
1185074359 22:48675382-48675404 GGGGATGCAGAGCAGCCTTCAGG + Intronic
1185157031 22:49199275-49199297 GGGGAGGCAGAGAGCCCTCAGGG - Intergenic
1185187687 22:49412447-49412469 GGGGAAGCAAAGAGGCCCCTCGG - Intergenic
1185314085 22:50171286-50171308 GGGGATGCAGGGTGGCCAGGTGG + Intronic
950176768 3:10880551-10880573 GGGGAGGAAGAGAAGCCTGCGGG + Intronic
950663175 3:14479563-14479585 GGGGAAGTAGAGGGGCCTTTGGG + Intronic
950710381 3:14809734-14809756 GGGAATGCACAGGCGCCTGTGGG - Intergenic
952609070 3:35185342-35185364 GTGGATGCAGAAATGGCTGTGGG - Intergenic
952849301 3:37714462-37714484 GGGGATGCTGAGAAGTCTGCAGG - Intronic
953979106 3:47404897-47404919 GGGGATGTGGGGAGGCCTGGGGG - Intronic
954425542 3:50441036-50441058 GTGGCTGCAGAGGGGCTTGTTGG + Intronic
954680280 3:52342210-52342232 TGGGATGCAGAGAGAGATGTTGG + Intronic
954717691 3:52534405-52534427 GGGGAGGCCGAGGGGCCTGCAGG + Intronic
955992485 3:64642862-64642884 GGAGAGGCAGAGAGGTCTGAAGG + Intronic
959598370 3:108152161-108152183 GTGGAAGCAGAGAGGCTTCTGGG + Intergenic
959840557 3:110969538-110969560 GGGGAAAGAGAGAGGCTTGTGGG - Intergenic
961435301 3:126912647-126912669 GGGGAGTCAGGGAGGCCTGGGGG - Intronic
961444623 3:126973362-126973384 GGGAATTCAGAGAGGACAGTGGG - Intergenic
961445059 3:126976526-126976548 GGGGCTGCAGAGAGGCTTCCTGG + Intergenic
961465596 3:127079072-127079094 GTGGAGGCAGAGAGGCCAGTAGG - Intergenic
961531475 3:127542835-127542857 GGTGGGGCAGAGGGGCCTGTGGG - Intergenic
961642804 3:128375491-128375513 GGGGAGGCAGAGAAGGCTGGTGG - Intronic
962674329 3:137743195-137743217 GAGGATGCAGAGTGGCATGAAGG - Intergenic
963111200 3:141689545-141689567 GGGTGGGCAGGGAGGCCTGTTGG + Intergenic
965485446 3:169272914-169272936 GGGGAGGCAGGGAGGACTGCGGG + Intronic
967106653 3:186259843-186259865 GGGGTTGTAAAGAGGCCTGGTGG - Intronic
967318172 3:188169988-188170010 GTGTAGGCAGAGAGGCCTGGAGG + Intronic
968460360 4:721689-721711 GGGTGTGGAGAGAGGCCTGTGGG + Intronic
968460375 4:721740-721762 GGGCATGGGGAGGGGCCTGTGGG + Intronic
968460393 4:721792-721814 GGGCATGGGGAGGGGCCTGTGGG + Intronic
968460406 4:721843-721865 GGGTGTGGAAAGAGGCCTGTGGG + Intronic
968460418 4:721894-721916 GGGCGTGGAGAGAGGCCTGTGGG + Intronic
968460431 4:721945-721967 GGGTGTGGGGAGAGGCCTGTGGG + Intronic
968959594 4:3736330-3736352 GGGGATGCGGGGAGGCTTCTGGG - Intergenic
969265195 4:6059845-6059867 GGGGAGCCAGAGAGGGCTCTGGG - Intronic
969365199 4:6690132-6690154 GGAGAAGCAGAGAGGCCAGGAGG - Intergenic
969371173 4:6732590-6732612 CAGGATGCAGAGAGACCTGGGGG - Intergenic
969568720 4:7995577-7995599 GGGGACACAGAGAAGCCTGTGGG + Intronic
969634273 4:8357282-8357304 GGGAATGCAGGGAGGACTCTGGG + Intergenic
969671030 4:8590531-8590553 GGGGATGGAGAGAGGGCTCCTGG - Intronic
969940274 4:10725013-10725035 GGTGAGGAGGAGAGGCCTGTGGG + Intergenic
970313217 4:14804560-14804582 GGGGCTGCAGGGAGGTCTGCAGG - Intergenic
970382664 4:15523709-15523731 GGGGTGGAAGAGAGGCCTGCCGG - Intronic
972109595 4:35541348-35541370 TGGGATCCAGGGAGGCCTGGGGG - Intergenic
972152884 4:36117025-36117047 GTGGATGTAAAGAGGACTGTTGG - Intronic
972483279 4:39518411-39518433 GAGGCTGCAGTGAGCCCTGTTGG - Intronic
975914523 4:79308417-79308439 GGGGAGGCAGAGGGGGATGTGGG - Intronic
976612559 4:87045059-87045081 GGGGAGGCAGGGAGACCAGTAGG + Intronic
976879269 4:89898815-89898837 GGGAATTCAAAGAGACCTGTAGG - Intronic
977027506 4:91837939-91837961 GGGCATGCAGAGAGAGCTGTGGG + Intergenic
977962154 4:103098400-103098422 GGGGATTTAGAGAGGCCCGCAGG - Intronic
982059013 4:151584362-151584384 AGGGATACAGAGAGTGCTGTGGG + Intronic
983862174 4:172720691-172720713 AGGGATGTAGACAGCCCTGTAGG + Intronic
984851200 4:184154088-184154110 GAGGGTGCAGAGAGGGCTCTGGG - Intronic
984854903 4:184186788-184186810 GCGGAAGCAGAGAGGCCTGTAGG - Intronic
985570193 5:640702-640724 GGGGCTGCAGAGATGGCAGTTGG - Intronic
985828716 5:2212729-2212751 GAGGAGGCAGAGAGGCCAGAGGG + Intergenic
985929970 5:3049496-3049518 TGGGATCCAGAGAGCTCTGTGGG - Intergenic
986254428 5:6090233-6090255 GGGGATGCTCAGGGGGCTGTGGG + Intergenic
986788639 5:11139312-11139334 TGGGATGCAGACAGGCTTCTTGG - Intronic
987234694 5:15930886-15930908 GTTGATGCAGAGAGGCCAGAGGG + Intronic
987651197 5:20742043-20742065 GGGGTGGCAGAGAGGCATGGAGG + Intergenic
988744365 5:34119406-34119428 GGGGTGGCAGAGAGGCATGGAGG - Intronic
988856567 5:35233286-35233308 AGTGCTGCAGAGAGGCCTGGAGG - Intergenic
991013148 5:61904706-61904728 GTAGAAGCAGAGAGGCTTGTCGG + Intergenic
991049724 5:62259788-62259810 GGGGAAACAGGGAGGGCTGTAGG + Intergenic
992014447 5:72561311-72561333 GGGGATGCATAGGGCCCTGTAGG - Intergenic
994042455 5:95274335-95274357 GTGGATGCAGGGAGGTCTGTAGG - Intronic
994352232 5:98759378-98759400 GTGGAAGCTGAGAGGCCTGTGGG - Intergenic
997462088 5:134059589-134059611 GCTGATGCTCAGAGGCCTGTGGG - Intergenic
997637407 5:135424032-135424054 GAGGTTGCAGAGACGCATGTGGG - Intergenic
997734298 5:136202138-136202160 GTGAAGGCAGAGAGGGCTGTGGG + Intergenic
998373637 5:141677594-141677616 GGAGAAGCAGAGAGACCAGTGGG - Intronic
998444327 5:142187000-142187022 GGGGGTGCAGGAAGGCCTGGGGG - Intergenic
999208917 5:149870719-149870741 GGGGATCCAGAGGGGCCTGCAGG + Intronic
999378260 5:151101829-151101851 GGGGGTGCACAGGGGCATGTTGG - Intronic
999837457 5:155389899-155389921 GGAGACGCAGAGATGTCTGTAGG + Intergenic
1000118605 5:158175962-158175984 TGGGAAGCAGAGAGGCCGGCAGG + Intergenic
1001109260 5:168882212-168882234 GGGGCTGCAGAGAAGGCTGCTGG + Intronic
1001396540 5:171422356-171422378 TTGGATGCAGAAAGGCCGGTGGG - Intronic
1001929479 5:175662581-175662603 GGGGAAGCAGGGAGGCCAGGTGG - Intronic
1001966332 5:175912268-175912290 GGGGCTGCAGTGAGGACTGAAGG + Intergenic
1002204360 5:177553065-177553087 AGGGAGGCACAGAGGGCTGTGGG + Intronic
1002250615 5:177926935-177926957 GGGGCTGCAGTGAGGACTGAAGG - Intergenic
1002273096 5:178085769-178085791 GAGGATGCAGTGAGCCCTGGTGG + Intergenic
1002437261 5:179239162-179239184 GGGGAGGCAGGGAGGTCTGCTGG + Intronic
1002583499 5:180225631-180225653 AAGGACGCAGAGAGGCCTCTAGG + Intergenic
1002706204 5:181162062-181162084 GGGGATGCTGGGAGGCGTTTGGG + Intergenic
1002781810 6:372838-372860 GGGGAGGGAGACAGGCCAGTGGG - Intergenic
1002856103 6:1039558-1039580 GAGGTTGCACAGAGGCCTGAGGG - Intergenic
1002973417 6:2048917-2048939 GGGGATGGAGATGGGCCTTTGGG + Intronic
1003037791 6:2660151-2660173 AGGGATTCAGACAGGCCTGATGG + Intergenic
1003341312 6:5223949-5223971 AGGAATCCAGAGAGTCCTGTAGG - Intronic
1006101795 6:31690165-31690187 AGGGATGGAGAAAGGGCTGTGGG - Intronic
1006404670 6:33838015-33838037 GGAGCTGCAGGGAGGCCTGGGGG + Intergenic
1006902298 6:37511028-37511050 GGGGATGGAGGGAGCCATGTAGG - Intergenic
1006912458 6:37572226-37572248 TGGGGTGCAGAGAGGCTGGTGGG + Intergenic
1007078289 6:39081648-39081670 GGGGATGCAGAAAGGACAGTGGG + Intronic
1007202411 6:40121138-40121160 GGGGATGCAGAGAGGCCAAAGGG - Intergenic
1007400470 6:41599809-41599831 AGGACTGCAGAGAGGCCTGCAGG - Exonic
1007599773 6:43074712-43074734 GGGAATGCTGTGAGGGCTGTGGG - Exonic
1007658724 6:43469140-43469162 GGGGGTGCAGAGGCACCTGTGGG + Intergenic
1007923296 6:45630034-45630056 TGGGAAGAGGAGAGGCCTGTGGG - Intronic
1008538342 6:52525203-52525225 CAGGAGGCAGAGAGGCCTGATGG - Intronic
1010888881 6:81280507-81280529 GGGTATGCAGAGAGACAGGTTGG - Intergenic
1012474230 6:99603480-99603502 GGGGATGCAGAGAGCCGCGCGGG - Intergenic
1012840752 6:104326272-104326294 AGGCATGCAGAGAGTCCTGTGGG + Intergenic
1012841876 6:104339279-104339301 GGTGATGGACAGAGGCCTGGAGG - Intergenic
1014279751 6:119428580-119428602 GGGGATTGAGATAGGCCTATGGG + Intergenic
1016492838 6:144626575-144626597 GGGGAAACTGAGTGGCCTGTAGG - Intronic
1016895994 6:149053773-149053795 GGGAATGCACAGAAGCCTGATGG + Intronic
1018258741 6:161948982-161949004 GGGGAGGCAGAGAGGCTGGAGGG + Intronic
1018267928 6:162044989-162045011 GGGGATGGAGTGAGACGTGTAGG - Intronic
1018457959 6:163969722-163969744 GGGGGTGCAGACAGGTCTGCAGG - Intergenic
1018891481 6:167986164-167986186 GGGGACTCAGAGAGGCCGGCTGG - Intergenic
1019588266 7:1816268-1816290 GGGGAGAGGGAGAGGCCTGTCGG - Intronic
1019598463 7:1869297-1869319 GGGAACTCAGAGAGGCCTCTGGG - Intronic
1019942629 7:4303156-4303178 GCGTAGGCAGAGAGGCCTGACGG - Intergenic
1021442297 7:20689943-20689965 GGGTAGGCAGAGAGGCGTGTGGG + Intronic
1022233838 7:28442073-28442095 GGGGATGAGGAGAGGACAGTGGG - Intronic
1022371633 7:29777072-29777094 GTGGAGGCAGAGAGACCAGTTGG + Intergenic
1022408591 7:30118021-30118043 GCGGGTGCAGAGTGGCCTGCAGG + Intronic
1022963841 7:35454988-35455010 GGAGGTGCAGAGAGGCCGCTGGG - Intergenic
1023829207 7:44029262-44029284 GGGGGTGCAGAGTGTCCTGGAGG + Intergenic
1024027352 7:45424043-45424065 GGGGCAGCAGAGAGGGGTGTAGG - Intergenic
1024201114 7:47106646-47106668 GGGGCTGTGGAGAGGCCTTTTGG - Intergenic
1024897625 7:54278992-54279014 GGGGAAGCAGTGGGGTCTGTAGG + Intergenic
1025231934 7:57208268-57208290 GTGGAAGAAGGGAGGCCTGTCGG + Intergenic
1025523762 7:61777729-61777751 GGGAGTGCACAGAGGCCTGGGGG - Intergenic
1025547121 7:62189932-62189954 GGGAGTGCACAGAGGCCTGGGGG - Intergenic
1026805166 7:73424746-73424768 GGGGCTGCACAGAGTGCTGTGGG - Intergenic
1027160815 7:75800795-75800817 TGGGAGGCAGAGGGGCATGTTGG - Intergenic
1028724032 7:94067080-94067102 GTGGATGCAGACAAGCCTGGTGG - Intergenic
1029373242 7:100162643-100162665 GGGGAAGAGGAGAGGCTTGTCGG + Intronic
1029739512 7:102483519-102483541 GGGGGTGCAGAGTGTCCTGGGGG + Exonic
1029757513 7:102582698-102582720 GGGGGTGCAGAGTGTCCTGGGGG + Exonic
1029775451 7:102681759-102681781 GGGGGTGCAGAGTGTCCTGGGGG + Intergenic
1030065602 7:105656480-105656502 GGGGATGCTGGGCAGCCTGTGGG + Intronic
1031162026 7:118180017-118180039 GAGGCTGCAGAGAGCCATGTTGG - Intergenic
1031988665 7:128180966-128180988 AGGGATTCAGAGAGACCAGTAGG + Intergenic
1032023179 7:128421440-128421462 GGGGATGGAGGGAGGCTTGGGGG - Intergenic
1032403957 7:131642518-131642540 GGGGATGGTGAGAGGACAGTGGG + Intergenic
1032986937 7:137347409-137347431 GTGGAAGCAGAGAGCCCAGTAGG + Intergenic
1034398829 7:150848100-150848122 GGGGGTGAAGAGGGGCTTGTGGG - Intronic
1035373341 7:158392758-158392780 GGGGATACCGGGAAGCCTGTGGG - Intronic
1035450433 7:158974014-158974036 GGGGGCGCGGAGAGGCCGGTGGG - Intergenic
1035724814 8:1817840-1817862 TGGGAGGCTGAGAGGCCTGAAGG + Intergenic
1038562881 8:28596003-28596025 GGGGGTGAAGAGAGCCATGTGGG - Intergenic
1038649568 8:29390243-29390265 GTGGGTGCAGAGAGGATTGTGGG + Intergenic
1039433918 8:37546798-37546820 CGGGATGCAGAGAGGTTTTTTGG + Intergenic
1040132953 8:43818759-43818781 GGGAGTGCACTGAGGCCTGTAGG + Intergenic
1040951001 8:52939281-52939303 GGGGAGGCTGAGACGCCTGCCGG - Exonic
1046714409 8:117551721-117551743 GGGGATGAGGAGAGGAATGTGGG + Intergenic
1048810334 8:138280122-138280144 GGGGTAGCAGAGAGGGCCGTGGG - Intronic
1049105366 8:140609188-140609210 GCGGCTGCAGAGAGGACTGCGGG + Intronic
1049229371 8:141474107-141474129 GAGGCTGCAGGGAGGCCAGTCGG - Intergenic
1049359242 8:142204140-142204162 GCGGATTCAGAGAGGCCAGGAGG + Intergenic
1049377026 8:142294142-142294164 GAGGATGCAGAGTGGCCAGAGGG + Intronic
1049582688 8:143420071-143420093 GGGCTTGCAGAGGGGCCTGGGGG - Intronic
1051334649 9:16054974-16054996 GTGGATGCAGAGAGGCCAGTTGG + Intronic
1053369589 9:37549433-37549455 GGGGACACAGAGAGGCTTTTAGG - Intronic
1054933595 9:70663226-70663248 GGGGATTCAGAGAGGAAGGTTGG + Intronic
1056500605 9:87205033-87205055 GGGGACACAGGGAGCCCTGTGGG - Intergenic
1057067508 9:92069191-92069213 GGGGCAGCAGAGAGGGCTGACGG + Intronic
1057454914 9:95199343-95199365 AAGGAGGCAGAGAGGGCTGTGGG - Intronic
1057699050 9:97349731-97349753 GGGGCTCCAGAGAGGCCATTTGG + Intronic
1057943864 9:99307720-99307742 GAGGCTGCAGTGAGGCCTGATGG + Intergenic
1059013289 9:110486572-110486594 GGAGAAGCAGAGAGGGATGTAGG - Intronic
1059341744 9:113601245-113601267 GGTGAAGCAGAGAGGCCTTCAGG - Intergenic
1059406351 9:114100088-114100110 GGGGGAGTACAGAGGCCTGTAGG + Intergenic
1059518093 9:114914312-114914334 GGGTATGCAGAGAAGCTGGTAGG - Intronic
1059530751 9:115033296-115033318 GGGGCTGCAAAAAGGCCTCTGGG - Intronic
1060207987 9:121693748-121693770 GGTGATGAAGACAGGCCTGGAGG + Intronic
1060407777 9:123381392-123381414 GGGGATGCACCGAGGCCCGAGGG - Exonic
1060799278 9:126533367-126533389 GGGGGTTCACAGAGGCCTGCGGG - Intergenic
1061316737 9:129801098-129801120 CAGGATGCACAGAGGCCTGTGGG - Intergenic
1061420855 9:130472238-130472260 GGGGATGCAGCTGGGCCTGGGGG + Intronic
1061500856 9:131001094-131001116 GGGCATGCAGATGGACCTGTGGG - Intergenic
1061636641 9:131914767-131914789 GTGGAGGCAGAGAGGCCAGTTGG + Intronic
1061666720 9:132164326-132164348 GGGGAGGCAGCGAGGCCCGGAGG - Intronic
1061791434 9:133061288-133061310 GGGGAGGGAAAGAGGCCAGTGGG - Intergenic
1061994750 9:134177751-134177773 GGGGATGCAGTGAAGCCTGTCGG + Intergenic
1062180290 9:135187762-135187784 GGGGCTGCAGAGGGGCCTTGGGG - Intergenic
1062265463 9:135684804-135684826 GGGGATGCAGAGGCCCCAGTCGG - Intergenic
1062399645 9:136366755-136366777 GGGGAAGCTGGGAGGCCTCTGGG + Intronic
1062737040 9:138143321-138143343 GGGAGTGCTGAGAGGCCTGAAGG + Intergenic
1186487718 X:9946425-9946447 GGAAACCCAGAGAGGCCTGTGGG + Intronic
1187104786 X:16230250-16230272 GGGGATGGACACATGCCTGTGGG - Intergenic
1188744833 X:33829475-33829497 GGGGATGCTGAAATTCCTGTAGG + Intergenic
1189445200 X:41074882-41074904 GGAGATGCAGAGAGGCAGGTTGG + Intergenic
1190915356 X:54808103-54808125 GGGGATGCAGAGAGGGATTAAGG + Intronic
1191108242 X:56785651-56785673 GCGACTGCATAGAGGCCTGTTGG - Intergenic
1191135765 X:57063341-57063363 GAGGAGACAGAGAGGCTTGTGGG + Intergenic
1191871228 X:65747252-65747274 GTGGAGGCAGAGAGACCTGTTGG - Intergenic
1193047790 X:77070680-77070702 GAGGATGCAGAGAGGCTGGCAGG + Intergenic
1195932015 X:110087912-110087934 CTGGATGGAGAGAGGACTGTAGG + Intronic
1197790705 X:130251215-130251237 GGGGATGCAGTGAGCCATGATGG + Intronic
1198911495 X:141620038-141620060 GGGGATGCAGAGAGGCTGAAGGG - Intronic
1199303708 X:146242237-146242259 GGGGAGACAGAGAGCCCTATAGG - Intergenic
1199604129 X:149563220-149563242 TGGGATGCAATCAGGCCTGTGGG - Intergenic
1199629906 X:149770206-149770228 GGGGAGGCAGAGAGGCCAACAGG - Intergenic
1200270301 X:154676438-154676460 GGTGATGCAGAGCTGGCTGTGGG + Intronic
1200900184 Y:8423626-8423648 CTGGAGGCAGAGAGGCCTGGAGG + Intergenic