ID: 1074530876

View in Genome Browser
Species Human (GRCh38)
Location 10:114297837-114297859
Sequence CAGGGTTAACAGGAGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 248}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074530876_1074530887 22 Left 1074530876 10:114297837-114297859 CCTGGCTCCTCCTGTTAACCCTG 0: 1
1: 0
2: 2
3: 31
4: 248
Right 1074530887 10:114297882-114297904 ACACCGTGAAATGATGCCTAGGG No data
1074530876_1074530886 21 Left 1074530876 10:114297837-114297859 CCTGGCTCCTCCTGTTAACCCTG 0: 1
1: 0
2: 2
3: 31
4: 248
Right 1074530886 10:114297881-114297903 CACACCGTGAAATGATGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074530876 Original CRISPR CAGGGTTAACAGGAGGAGCC AGG (reversed) Intronic
901829187 1:11881714-11881736 CAGGGGAATAAGGAGGAGCCAGG + Intergenic
902966173 1:20004828-20004850 CAGGGTTAACAAGAATATCCAGG + Intergenic
904844263 1:33396967-33396989 TAGTGTTAACACGAGGAGTCTGG + Intronic
904900051 1:33849980-33850002 AAGGGTAAAGAGGAGGAGGCAGG - Intronic
913957352 1:143318289-143318311 CAGGGCCAAAAGGAGGGGCCAGG + Intergenic
914051666 1:144143653-144143675 CAGGGCCAAAAGGAGGGGCCAGG + Intergenic
914127531 1:144822888-144822910 CAGGGCCAAAAGGAGGGGCCAGG - Intergenic
915270378 1:154749587-154749609 CAGGGTGCCAAGGAGGAGCCTGG + Intronic
915290850 1:154882193-154882215 CTGGGGTGACAGGAGAAGCCAGG - Intergenic
916741619 1:167651380-167651402 CAGGCATGACAGAAGGAGCCAGG - Intronic
918181151 1:182086779-182086801 CAGGGTTGACAGGAAGGGACAGG + Intergenic
919618308 1:199835070-199835092 CAGGGTTCACATGGGAAGCCTGG + Intergenic
919738821 1:200970450-200970472 AAAGATTAACAGGCGGAGCCTGG - Intronic
922562915 1:226582080-226582102 CAGGGCTTCCAGGAGGAGGCTGG - Intronic
922762959 1:228143734-228143756 CTGGGTGAGCAGCAGGAGCCAGG + Intronic
922959747 1:229636260-229636282 CATGTTCAACATGAGGAGCCTGG + Exonic
924277208 1:242400968-242400990 CAGGGCTCAGAGGAGGGGCCAGG - Intronic
1063277835 10:4590598-4590620 CAGGATGAACAGCAGGAGCCAGG + Intergenic
1064502454 10:15989070-15989092 CAGGGTAAACACCAGGAGGCAGG + Intergenic
1064566968 10:16650239-16650261 AAAGGTTGACAGGAGGAGGCAGG + Intronic
1064746117 10:18479785-18479807 CAGGCTTAACAGGAGGCCTCAGG - Intronic
1065044950 10:21738817-21738839 CAGGCTGAAGAGGAGGACCCAGG - Intronic
1067167079 10:43873886-43873908 CAAGGTTAGCAAGAGGAGCCCGG - Intergenic
1067769023 10:49110218-49110240 TAGCATTAATAGGAGGAGCCTGG - Intronic
1067947094 10:50696494-50696516 CAAGGTCAGCAGGAGGACCCAGG - Intergenic
1071427753 10:85576278-85576300 TAGGTTTAGAAGGAGGAGCCTGG - Intergenic
1072008866 10:91286269-91286291 CAGGGTTTGCAGGAGGAGCAGGG - Intergenic
1072430310 10:95365393-95365415 CAGGGTTAACACGGGCAGTCAGG + Intronic
1073778226 10:106809441-106809463 CAGGGCTAGCAGGGGGATCCTGG - Intronic
1074530876 10:114297837-114297859 CAGGGTTAACAGGAGGAGCCAGG - Intronic
1075023688 10:118968601-118968623 CAGCGGGAACAGGAGGGGCCAGG + Intergenic
1075024100 10:118971037-118971059 GAGGGGTAACCGGAGGGGCCGGG - Intergenic
1075922723 10:126226312-126226334 CAGGAATAAGAGGAGAAGCCGGG + Intronic
1076479732 10:130777330-130777352 CAGGGCAGACTGGAGGAGCCTGG + Intergenic
1077065238 11:638130-638152 CAGGGTTCTCAGCAGGGGCCTGG - Intronic
1079124362 11:17708314-17708336 CAGGGTGCACAGTAGGAGCTTGG - Intergenic
1081512626 11:43791162-43791184 CAGGGTTCACTGGAAGAGCCTGG - Intronic
1081738762 11:45423601-45423623 CTGGGCTAAGAGGAGGAGACTGG - Intergenic
1081910740 11:46698298-46698320 CAGGATTAGAAGGAGCAGCCGGG + Intronic
1083473555 11:62900669-62900691 CAGATTTAAGAGGAGGAGGCTGG + Intergenic
1083495761 11:63051651-63051673 CAGGGCTTACTGGAGGAACCAGG - Intergenic
1083629772 11:64089514-64089536 CATGGATAACAGGAGGAGGCTGG - Intronic
1084446639 11:69207455-69207477 CAGGGATGGCAGGAGGTGCCGGG - Intergenic
1089325851 11:117656300-117656322 CAGGGTTACCTGGTGGAGCCAGG - Intronic
1090362981 11:126186294-126186316 CAGGGTTTACAGGTGGCTCCTGG + Intergenic
1091883537 12:3999385-3999407 CAGGGTTAAGGGTAGGAGCCAGG + Intergenic
1092024840 12:5231898-5231920 CAGGGCTCACAGGAGGGGCTCGG - Intergenic
1092054812 12:5500039-5500061 CAGCCTAAACAGAAGGAGCCGGG + Intronic
1092261798 12:6956829-6956851 CAGGGAGGACAGGAGGGGCCTGG - Intronic
1095580011 12:43786985-43787007 CAGGGTTAGCAAAAAGAGCCTGG + Exonic
1096144014 12:49265294-49265316 CCAGGTTAACCGGAGGGGCCCGG - Intronic
1096560954 12:52435540-52435562 CAAGGTTAACAGGAGAAACAGGG - Intergenic
1096599790 12:52721384-52721406 GAGGCTTCAGAGGAGGAGCCAGG - Intergenic
1096817145 12:54208808-54208830 CAGGGTTCAAAGGAGGGGCTGGG - Intergenic
1097287205 12:57887520-57887542 CAGGGTCAACAGGACAAGCCAGG + Intergenic
1100167632 12:91935523-91935545 CAAGGTTAACAGGAAGAGGTAGG + Intergenic
1100793146 12:98152567-98152589 CAGAGGTACCAGGAGGAGACAGG + Intergenic
1101062116 12:100983230-100983252 CAGCCTTAACAGTGGGAGCCTGG + Intronic
1101444043 12:104724562-104724584 CAGGGTTAGGAGCAGCAGCCAGG + Intronic
1101498823 12:105281844-105281866 AAGGGAAAACAGAAGGAGCCTGG + Intronic
1104685930 12:130783934-130783956 CAGGTTTCACAGGTTGAGCCTGG + Intergenic
1104687015 12:130793143-130793165 CAGGGTTATCAAGAGGCGCATGG + Intronic
1104842818 12:131832716-131832738 CAGGGTCCACAGGGGAAGCCAGG - Intronic
1105751399 13:23425164-23425186 CAAGGTGAACAGGAGGCCCCAGG - Intronic
1105898483 13:24738375-24738397 CAGGGAGAACAGAAGGGGCCTGG - Intergenic
1106346420 13:28883664-28883686 AAGGGGTAGCAGGAGGAGGCAGG + Intronic
1107617756 13:42189092-42189114 CAGGGAGAACAGGCGCAGCCTGG - Exonic
1111063863 13:83064034-83064056 TAGAGTTAACAGGAGGAGAATGG - Intergenic
1112433174 13:99370799-99370821 CAGGATTAACAGGTGGAGTATGG + Intronic
1113394457 13:109933719-109933741 CAGGGTGAAGAGGAGGAGTGTGG - Intergenic
1113424707 13:110198494-110198516 CAGGGGAACCAGGAGGACCCGGG + Exonic
1113693615 13:112329179-112329201 CAGGGTGGACAGAAGGACCCAGG - Intergenic
1114366662 14:22034294-22034316 CAGTGTGAACAGGAAGAGGCAGG + Intergenic
1114557707 14:23571319-23571341 CAGGGTTGGCGGGAGGAGGCAGG + Exonic
1114796086 14:25716672-25716694 GAGGGTTGAGAGGAGGAGGCAGG + Intergenic
1115117545 14:29900309-29900331 AATGGTTAGGAGGAGGAGCCTGG - Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1118805139 14:69229572-69229594 AAGGCTTATTAGGAGGAGCCAGG - Intronic
1118878986 14:69810302-69810324 CAGGGACAGCAGGAGGAGCTGGG - Intergenic
1119021992 14:71124015-71124037 CAGGATCACCAGGAGGAGGCGGG - Intergenic
1119379495 14:74219516-74219538 GCGGGTTTCCAGGAGGAGCCAGG + Intergenic
1119583154 14:75805983-75806005 TAGGGTGAACAGGAAGAGACTGG - Intronic
1202931018 14_KI270725v1_random:31756-31778 CAGGGCCAAAAGGAGGGGCCAGG - Intergenic
1123421412 15:20139922-20139944 CAGGGCCAAAAGGAGGGGCCAGG + Intergenic
1123530638 15:21146462-21146484 CAGGGCCAAAAGGAGGGGCCAGG + Intergenic
1124121640 15:26893682-26893704 CAGGGGAAACAGGAGGATCTGGG + Intronic
1124156771 15:27233027-27233049 CAGGGACAAGAGGAGGTGCCTGG - Intronic
1125534567 15:40436020-40436042 TAGGGTTACCACGGGGAGCCAGG - Intergenic
1125750841 15:42027172-42027194 CAGTGTTGACAGGAAGAGGCAGG + Intronic
1128240113 15:66095994-66096016 CAGTGAGAACAGGGGGAGCCCGG - Intronic
1128735454 15:70051287-70051309 CAGGAAGAACAGGAGGAGCCTGG - Intronic
1128800784 15:70495511-70495533 CAGGGCTGACAGGAGAGGCCTGG - Intergenic
1129323306 15:74786743-74786765 CAGGGTTGCCAGGAGGAGACTGG - Intronic
1129890446 15:79068233-79068255 CAGCGTGAACAGAAGGACCCTGG - Intronic
1131905689 15:97139526-97139548 CAGTGTAAACAGCAGGGGCCAGG - Intergenic
1132804869 16:1770824-1770846 CAGGCTGAACAGGGGGAGGCCGG + Intronic
1133008704 16:2898382-2898404 CAAGGTTGGCAGGAGAAGCCAGG - Intronic
1133039909 16:3055160-3055182 CAAGGATGACAGGAGGTGCCGGG + Intronic
1134121587 16:11587753-11587775 CAGTGATAACAGCAGCAGCCTGG + Intronic
1136057544 16:27701629-27701651 CCGGGGCAGCAGGAGGAGCCAGG + Exonic
1137948179 16:52755975-52755997 CAGAGTAACCAGGAGGAGCCAGG + Intergenic
1137979160 16:53055166-53055188 CAGAGATAACCGGAGGAGTCGGG + Intronic
1139109918 16:63877577-63877599 CAGGGCTAAGAGGGTGAGCCAGG - Intergenic
1139873667 16:70127923-70127945 CAGCGAGAACAGGAGCAGCCTGG + Intronic
1140958886 16:79893759-79893781 CAGGGTAAAAAGGATGAGGCAGG + Intergenic
1142582046 17:949013-949035 CAGGGGGGAGAGGAGGAGCCCGG - Intronic
1143376868 17:6472172-6472194 CAGGGAGAACAGCAGGAGCGAGG - Intronic
1143405577 17:6675202-6675224 CTGGGTTACCAGCAGGAGTCAGG + Intergenic
1143777128 17:9206678-9206700 CAGCTCTCACAGGAGGAGCCAGG - Intronic
1144202228 17:12952021-12952043 CGGGGGCCACAGGAGGAGCCAGG + Intronic
1144341005 17:14310277-14310299 TAGGGTTAGGAGGACGAGCCTGG - Intronic
1148264569 17:46215275-46215297 CAGGGTTCACAGAAGGAACTGGG + Intronic
1148392073 17:47279937-47279959 CAGGGACAACAGGAGGAGTCTGG + Intronic
1148546382 17:48522319-48522341 CAGAGCCAACAGGAGGAGGCTGG + Intergenic
1148805365 17:50261176-50261198 AGGGGTGACCAGGAGGAGCCCGG + Intergenic
1150215669 17:63467573-63467595 CAGAGTTAACAGAAGCAGCCGGG + Intergenic
1155376820 18:25168084-25168106 CTGGGTTAACATGAGAAGCCTGG - Intronic
1156986356 18:43355352-43355374 CAGGGTCAACAGTAGGATCTGGG - Intergenic
1160672812 19:374214-374236 CAGTGGGGACAGGAGGAGCCCGG + Intronic
1160906931 19:1455958-1455980 CGGGGTTATCAGGAAGAGGCGGG + Intronic
1162811105 19:13164676-13164698 AAGGGTTAACAGGAAGTGCCTGG - Intergenic
1164564303 19:29314921-29314943 CAGGGTGGAGAGGAGGAGGCTGG + Intergenic
1165622796 19:37262545-37262567 CAGGGATTCCAGGAGGATCCAGG - Intergenic
1165634490 19:37329175-37329197 CAGGGATTCCAGGAGGATCCAGG - Intronic
1166077558 19:40422648-40422670 CAGGGCTGGCAGGGGGAGCCTGG - Exonic
1166289138 19:41850624-41850646 AAGGGGTCACACGAGGAGCCTGG - Exonic
1167665704 19:50821901-50821923 CAGGGTTGGCAGGAGAGGCCAGG + Intronic
1167671483 19:50856188-50856210 CAGGGTTGACAGGAGGAACTGGG - Intronic
1167785172 19:51630114-51630136 CAGGGGTAAGAGAAGGAGCAGGG + Intronic
1167787271 19:51646538-51646560 CAGGGGTAAGAGAAGGAGCAGGG + Exonic
1202691062 1_KI270712v1_random:96077-96099 CAGGGCCAAAAGGAGGGGCCAGG + Intergenic
924988165 2:289036-289058 CAGGGGGAAGAGGAGGAGACGGG - Intergenic
925180020 2:1811526-1811548 CAGGGCAAGCAGGAGAAGCCAGG - Intronic
925208687 2:2028266-2028288 CAGGCTCTGCAGGAGGAGCCTGG + Intronic
925389614 2:3486363-3486385 CAGGGTGACCAGAAGGAGCCAGG - Intergenic
926784971 2:16509589-16509611 CAGGGATGCCAGGAGCAGCCGGG - Intergenic
928579332 2:32691030-32691052 CAGTGTTTAAAGGAGTAGCCTGG + Intronic
930148375 2:48031447-48031469 CAGGGAGAACAGGATGACCCTGG - Intergenic
931135566 2:59395731-59395753 CAGGCTTCACAGAAGGAGCCTGG - Intergenic
931874634 2:66498525-66498547 CAGTGCTAACAGGAGGAGCTGGG + Intronic
932569770 2:72932439-72932461 CAGCGTTGGCAGGAGGATCCTGG - Intronic
933209877 2:79553750-79553772 CAGTGATAAGAGGAGAAGCCTGG - Intronic
933780809 2:85799638-85799660 CAGGGTCAACATGTGGACCCTGG + Intergenic
933874305 2:86602845-86602867 CTGGGTTCACAGGAGTAGCAGGG - Intronic
933955331 2:87357874-87357896 CAGGGCCAAAAGGAGGGGCCAGG - Intergenic
934239519 2:90254087-90254109 CAGGGCCAAAAGGAGGGGCCAGG - Intergenic
934273676 2:91562656-91562678 CAGGGCCAAAAGGAGGGGCCAGG + Intergenic
934461963 2:94217441-94217463 CAGGGCCAAAAGGAGGGGCCAGG - Intergenic
934960330 2:98667339-98667361 CTGGGTTAACAGGCAGAGGCTGG + Intronic
935361448 2:102250070-102250092 CATGGTAACCTGGAGGAGCCTGG - Intergenic
935604013 2:104951626-104951648 CAGGGCTAAGGGGAGGAGGCGGG - Intergenic
937478113 2:122233049-122233071 CAGAGATAATGGGAGGAGCCTGG + Intergenic
941736318 2:168980923-168980945 CAGGGTAGAGAGGAGGAGACTGG - Intronic
942613048 2:177761998-177762020 TAGGGTCAACAGCAGGAGGCGGG + Intronic
942710111 2:178824700-178824722 CAGGTTTAACAGGATGTTCCTGG - Intronic
943175309 2:184465773-184465795 AAGGTTTAACAAGAGAAGCCAGG + Intergenic
943595492 2:189850321-189850343 CAGGGTTAAGAAGAGGAGATGGG + Intronic
944097497 2:195985422-195985444 AAGGGATAACTGAAGGAGCCAGG + Intronic
944594082 2:201245697-201245719 CAGGGTCAACAGGAGCTGCCTGG - Intronic
946705551 2:222455277-222455299 CAGGGTTATGATGTGGAGCCAGG + Intronic
948866162 2:240775852-240775874 CAGGTTTTCCCGGAGGAGCCAGG + Exonic
1168853126 20:990070-990092 AAGCATTCACAGGAGGAGCCAGG + Intronic
1170629964 20:18057598-18057620 CCTGGTGAAGAGGAGGAGCCTGG - Exonic
1173082115 20:39878067-39878089 CAGGGCAGACAGGAGTAGCCAGG + Intergenic
1173662835 20:44745936-44745958 CAGGGTGCACAGGACCAGCCCGG - Exonic
1175182161 20:57156313-57156335 CTGGGGTAACGGGAGAAGCCAGG + Intergenic
1176593041 21:8660378-8660400 CAGGGCCAAAAGGAGGGGCCAGG - Intergenic
1179564766 21:42240321-42240343 AAGAGCAAACAGGAGGAGCCAGG - Intronic
1179933878 21:44590660-44590682 CAGGGGTAACAGGAGGGGTGAGG + Intronic
1179941017 21:44638880-44638902 CAGGGGTAACAGGAGGGGTGAGG - Intronic
1180275888 22:10637505-10637527 CAGGGCCAAAAGGAGGGGCCAGG - Intergenic
1180940483 22:19657289-19657311 CAAGGTGAACAGGAGGCCCCAGG + Intergenic
1181271540 22:21661467-21661489 CATGCTTACCAGGGGGAGCCAGG + Intronic
1181354287 22:22289328-22289350 CAGGGCCAAAAGGAGGGGCCAGG + Intergenic
1181615231 22:24049714-24049736 CAGTCTTAACAAAAGGAGCCTGG - Intronic
1182821711 22:33222309-33222331 GAGGGTTACCAGCATGAGCCTGG + Intronic
1183018095 22:35006438-35006460 CAGGGCTAAAAGCAGGAGCCAGG + Intergenic
1183970507 22:41474038-41474060 GAGGGTCAAAAGGAGGAGGCAGG + Intronic
1184690340 22:46114556-46114578 CTGGGTCAACAGGAGGGGCGAGG - Intergenic
1184775188 22:46619637-46619659 CAGAGTGAACAGGAGGACCGGGG - Intronic
1184824159 22:46935830-46935852 CAGAGTTCAGAGGAGGGGCCAGG - Intronic
1184824169 22:46935890-46935912 CAGAGTTCAGAGGAGGGGCCAGG - Intronic
1184824178 22:46935950-46935972 CAGAGTTCAGAGGAGGGGCCAGG - Intronic
1185088979 22:48755460-48755482 CAGGCTGATCAGGGGGAGCCAGG + Intronic
1185116468 22:48941040-48941062 CAGGGCTCACAGTAGGAGCCAGG + Intergenic
1185330593 22:50250552-50250574 CAGGGTCACCAGCAGGAGCAGGG + Intronic
949842777 3:8338142-8338164 GAGGTTTAACAGCAGGAGCCTGG + Intergenic
952258378 3:31714850-31714872 CAGTGTTAAGAGGAGGCGTCTGG - Intronic
953385478 3:42503413-42503435 GGTGGTTAACAGGAGGGGCCAGG + Intronic
953720743 3:45352718-45352740 CAGCGTGCAAAGGAGGAGCCTGG - Intergenic
954153487 3:48671702-48671724 CAGGGTTAAAAGTAGTAACCAGG + Intergenic
956095481 3:65711731-65711753 GAGGGATAACAGCAGGAGTCTGG + Intronic
956668220 3:71661878-71661900 AGTGGTTAAGAGGAGGAGCCTGG + Intergenic
960284370 3:115810718-115810740 CAGGGCCAACAGGAGGAGGCTGG - Intronic
961147091 3:124603328-124603350 CAAGGCTACCAGGAGGAGGCAGG - Intronic
961319636 3:126063834-126063856 CAGGGTTAGCAGGAGGCACATGG + Intronic
964060652 3:152518311-152518333 CAGAGTTGCCAGGAGGAGCAGGG - Intergenic
964921528 3:161902128-161902150 GAGGGATAACATGGGGAGCCTGG + Intergenic
969193886 4:5545505-5545527 CAGAGTTATCAGGAGGAAGCAGG + Intronic
969690495 4:8701552-8701574 GAGGGAAAACAGGAGGAGCTGGG + Intergenic
969731621 4:8960922-8960944 CAGGGTTCACCGGAGGAGATGGG - Intergenic
970956967 4:21824158-21824180 CAGGAATAACAGGAGCAGCTTGG - Intronic
971664707 4:29467454-29467476 CAGGGCAGACAGGAGGAGCTGGG + Intergenic
977564105 4:98564129-98564151 CAGTGATAACAGGAGGGGCTGGG - Intronic
984716697 4:182932527-182932549 CAGGGATAAGTGGCGGAGCCAGG + Intergenic
985553381 5:544321-544343 GTGGGTTCACAGGTGGAGCCTGG + Intergenic
985677877 5:1241674-1241696 TAGGATTTACAGGATGAGCCGGG + Intronic
985680878 5:1254973-1254995 CAGGGCAAACAGGAGAGGCCAGG + Intronic
986729364 5:10623806-10623828 CTGGGTGGACAGGAGGAGGCGGG + Intronic
990450431 5:55927946-55927968 CAGTGTTCACAGGAGGGTCCAGG - Intergenic
991748852 5:69777034-69777056 CAGGGTTGACAGGAGATCCCAGG - Intergenic
991800430 5:70356846-70356868 CAGGGTTGACAGGAGATCCCAGG - Intergenic
991828170 5:70653195-70653217 CAGGGTTGACAGGAGATCCCAGG + Intergenic
991892788 5:71356286-71356308 CAGGGTTGACAGGAGATCCCAGG - Intergenic
998781382 5:145660419-145660441 GAGGGTTAGGAGGAGGAGCCAGG - Intronic
999836392 5:155377791-155377813 CAGAGGTACAAGGAGGAGCCGGG - Intergenic
1001098949 5:168798123-168798145 CAGGCTTAACAGGCTAAGCCTGG - Intronic
1001537415 5:172508031-172508053 CAGGGTTAACTGGACAATCCAGG - Intergenic
1001758120 5:174186301-174186323 CAGAGGGAGCAGGAGGAGCCGGG - Intronic
1002419310 5:179137478-179137500 CACGGTGAACTGCAGGAGCCCGG + Intronic
1003720284 6:8693775-8693797 CTAGGTTAAGAGGTGGAGCCAGG - Intergenic
1005882116 6:30069821-30069843 AAGGGTTAGCAGGAGGAGAAGGG - Exonic
1006291764 6:33143269-33143291 CATGGCTCACAGGAGGATCCTGG + Intergenic
1006515877 6:34545298-34545320 CAGGCTTTCCAGGAGGAGCCAGG + Intronic
1006818075 6:36867110-36867132 CATGTTTCACAGGACGAGCCAGG + Intronic
1008319012 6:50083726-50083748 CAGGGTTAACATGAGAAGTCAGG + Intergenic
1010732770 6:79408790-79408812 CAGGGCTATCACAAGGAGCCAGG - Intergenic
1011771892 6:90682623-90682645 CATTGTTAGTAGGAGGAGCCTGG + Intergenic
1012258912 6:97065000-97065022 CAGGGTTCCCTGCAGGAGCCGGG + Intronic
1013423390 6:109987333-109987355 CAGGCTTGACAGGAGGAGGATGG + Intergenic
1014783334 6:125589488-125589510 CATGGCTAACAGAAGGAGCTGGG - Intergenic
1015217375 6:130765944-130765966 CAGTGTTAACAAGAGGATCCAGG - Intergenic
1016892063 6:149016690-149016712 CTGCATTAACAGGAGGAGCAGGG - Intronic
1017947555 6:159108004-159108026 CAGAGTTTAATGGAGGAGCCCGG + Intergenic
1018752696 6:166821472-166821494 CAGCGTTTACAGGAGAAGCCGGG - Intronic
1019317504 7:395365-395387 CAAGGACAACATGAGGAGCCTGG - Intergenic
1019346845 7:535288-535310 CAGGGTGAAGAGGAGGAGCCGGG - Intergenic
1019903307 7:4041585-4041607 AGGGGTGAACAGGAGGAGCATGG - Intronic
1020803276 7:12758215-12758237 CATGGTAAACAGGAGAAGCGTGG - Intergenic
1021863714 7:24933027-24933049 CACGGTTCACAGGAGGAGAATGG + Intronic
1023781616 7:43661013-43661035 CAGGGTGGACAGGAAGTGCCAGG - Intronic
1023840216 7:44092891-44092913 CAGCTTTAACAGTAGGGGCCAGG + Intergenic
1034572249 7:151965580-151965602 CAGCGTTAACAGTAGGAGGCTGG + Intronic
1035471072 7:159109273-159109295 CTGGGTGCAGAGGAGGAGCCTGG + Intronic
1035786818 8:2267868-2267890 CAGGGTTATCTGCAGGAGACAGG - Intergenic
1035805989 8:2453848-2453870 CAGGGTTATCTGCAGGAGACAGG + Intergenic
1035908906 8:3543917-3543939 CAGTGTTTACAGGAAGAGACAGG + Intronic
1037699630 8:21262826-21262848 CTTGGTTAACAAGAGAAGCCAGG + Intergenic
1039623684 8:39025400-39025422 CAGGGTGAACATGAGGAGTAAGG - Intronic
1046046334 8:108969099-108969121 CAAGGTTAAGAGTAGGGGCCTGG + Intergenic
1047268467 8:123331054-123331076 CTGGGATTACAGGAGGAGCTGGG + Intronic
1047851546 8:128862963-128862985 CAGGGATAAGGGGAGGAGTCAGG - Intergenic
1048163692 8:132043286-132043308 CAGGGTTAACAGGAGGCCTATGG - Intronic
1049113507 8:140665320-140665342 CAGGGTTGGCAGTTGGAGCCAGG - Intronic
1051269542 9:15342084-15342106 CAGGCTTAAGAGGCGGAGCGGGG - Intergenic
1053577086 9:39364094-39364116 CAGGATCAGCAGGAGGAGCTGGG + Intergenic
1053692442 9:40593119-40593141 CAGGGCCAAAAGGAGGGGCCAGG - Intergenic
1053841592 9:42192019-42192041 CAGGATCAGCAGGAGGAGCTGGG + Intergenic
1054098657 9:60922784-60922806 CAGGATCAGCAGGAGGAGCTGGG + Intergenic
1054120057 9:61198413-61198435 CAGGATCAGCAGGAGGAGCTGGG + Intergenic
1054272374 9:63044414-63044436 CAGGGCCAAAAGGAGGGGCCAGG + Intergenic
1054303684 9:63394037-63394059 CAGGGCCAAAAGGAGGGGCCAGG - Intergenic
1054402462 9:64720547-64720569 CAGGGCCAAAAGGAGGGGCCAGG - Intergenic
1054436072 9:65204878-65204900 CAGGGCCAAAAGGAGGGGCCAGG - Intergenic
1054494320 9:65816809-65816831 CAGGGCCAAAAGGAGGGGCCAGG + Intergenic
1054587699 9:66984149-66984171 CAGGATCAGCAGGAGGAGCTGGG - Intergenic
1055011150 9:71566867-71566889 GAGAGATAACAGGAAGAGCCTGG + Intergenic
1056728661 9:89144514-89144536 CAGGTTTCACTGGAGGAGCCAGG + Intronic
1060874124 9:127067845-127067867 CAGGCTTAAAAGGAGGAGTTCGG - Intronic
1061352883 9:130079714-130079736 CAGGGTTAACATTAGGCTCCTGG - Exonic
1062233373 9:135495777-135495799 CAGTGTTAACAGCAAGTGCCAGG - Intronic
1203623085 Un_KI270749v1:139185-139207 CAGGGCCAAAAGGAGGGGCCAGG - Intergenic
1185462412 X:339450-339472 CAGGGGTGAGGGGAGGAGCCGGG + Intronic
1185861856 X:3587197-3587219 CAGGGTTATGAGGTGGTGCCTGG - Intergenic
1186606463 X:11097963-11097985 AAGGGTTACCAGGATGAGCAAGG + Intergenic
1189263349 X:39694007-39694029 CAGGCTGAAAAGGAGGTGCCTGG - Intergenic
1191111383 X:56805433-56805455 CAGGTTTTACGGGAGGTGCCTGG - Intergenic
1196235553 X:113275477-113275499 CAATGTTAACAGGAGGACCAAGG + Intergenic
1197790770 X:130251816-130251838 CAGAGGTGACAGAAGGAGCCAGG + Intronic
1198254032 X:134909425-134909447 CAGAGTAAACAGCAAGAGCCAGG - Intronic
1199152420 X:144503324-144503346 CAGGGTGAATAGGTGGTGCCTGG + Intergenic
1199974220 X:152883119-152883141 CAGGGTCAACAGGAGCAGCCAGG + Intergenic