ID: 1074531147

View in Genome Browser
Species Human (GRCh38)
Location 10:114299724-114299746
Sequence GTGCCCACCCAGACTGAGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3103
Summary {0: 3, 1: 122, 2: 578, 3: 1109, 4: 1291}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074531147_1074531153 28 Left 1074531147 10:114299724-114299746 CCGCTCTCAGTCTGGGTGGGCAC 0: 3
1: 122
2: 578
3: 1109
4: 1291
Right 1074531153 10:114299775-114299797 ATAAAGCAGGCAGAAGAACATGG 0: 22
1: 76
2: 345
3: 594
4: 1007
1074531147_1074531149 0 Left 1074531147 10:114299724-114299746 CCGCTCTCAGTCTGGGTGGGCAC 0: 3
1: 122
2: 578
3: 1109
4: 1291
Right 1074531149 10:114299747-114299769 CACCTAATCAGCTGCCAGCATGG No data
1074531147_1074531152 15 Left 1074531147 10:114299724-114299746 CCGCTCTCAGTCTGGGTGGGCAC 0: 3
1: 122
2: 578
3: 1109
4: 1291
Right 1074531152 10:114299762-114299784 CAGCATGGCTAGAATAAAGCAGG 0: 62
1: 144
2: 277
3: 243
4: 373

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074531147 Original CRISPR GTGCCCACCCAGACTGAGAG CGG (reversed) Intronic
Too many off-targets to display for this crispr