ID: 1074531284

View in Genome Browser
Species Human (GRCh38)
Location 10:114300534-114300556
Sequence TGTCCAGGCAGGACAACGTC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 120}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074531279_1074531284 -2 Left 1074531279 10:114300513-114300535 CCGGGAGGGCCTCAGTTGCATTG 0: 1
1: 0
2: 0
3: 10
4: 153
Right 1074531284 10:114300534-114300556 TGTCCAGGCAGGACAACGTCGGG 0: 1
1: 0
2: 0
3: 13
4: 120
1074531278_1074531284 8 Left 1074531278 10:114300503-114300525 CCTGAGTCTGCCGGGAGGGCCTC 0: 1
1: 0
2: 3
3: 7
4: 167
Right 1074531284 10:114300534-114300556 TGTCCAGGCAGGACAACGTCGGG 0: 1
1: 0
2: 0
3: 13
4: 120
1074531275_1074531284 14 Left 1074531275 10:114300497-114300519 CCTGGGCCTGAGTCTGCCGGGAG 0: 1
1: 0
2: 0
3: 21
4: 270
Right 1074531284 10:114300534-114300556 TGTCCAGGCAGGACAACGTCGGG 0: 1
1: 0
2: 0
3: 13
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074531284 Original CRISPR TGTCCAGGCAGGACAACGTC GGG Exonic
900762518 1:4482629-4482651 TGGCCACGCAGGACAGCGTTCGG - Intergenic
901144884 1:7058057-7058079 TGTCCAGGCAGGACGGAGACCGG + Intronic
903832717 1:26184264-26184286 TGTCCAGGCAGGGCTGGGTCCGG - Exonic
904682829 1:32240886-32240908 ATTCCAGGGAGGACAGCGTCCGG + Intergenic
912882243 1:113427216-113427238 TGCCCAGGCTGGACCACCTCTGG + Intronic
923165834 1:231360769-231360791 TGTCCAGGCAGGACCTCTACTGG - Intergenic
924625424 1:245693311-245693333 TGTCCAGGCGGGCCAAGGTCTGG - Intronic
1072624548 10:97102758-97102780 TGTCCAGGGAGCACAAGGCCTGG + Intronic
1074531284 10:114300534-114300556 TGTCCAGGCAGGACAACGTCGGG + Exonic
1075253680 10:120906920-120906942 TGTCCAGGCAGCACAACTAAGGG - Intronic
1075346971 10:121689692-121689714 TGAATAGGCAGGAGAACGTCAGG + Intergenic
1075573134 10:123559464-123559486 TGTCCAAGAAGGACACCGACGGG + Intergenic
1075714424 10:124547933-124547955 TGTCCAGGCAGGGCAGCCTCTGG + Intronic
1077174980 11:1185031-1185053 TCTCCAGCCAGCACAACCTCTGG + Intronic
1079709374 11:23662415-23662437 TGTCCAGCCAGGACACTGTTGGG - Intergenic
1081355320 11:42105625-42105647 TGGCCAGGCTGGTCAACCTCAGG - Intergenic
1083272118 11:61577887-61577909 TGGGCAGGCAGGACAGCGGCAGG - Intronic
1084636674 11:70397879-70397901 TTTCCAGGCAGGCCAACAGCAGG - Intergenic
1090365288 11:126200265-126200287 TGTGCAGGGAGGACAAGGTGTGG - Intergenic
1090836228 11:130456003-130456025 AGTCCAGGCAGCACAGCGGCAGG - Intronic
1093824246 12:23663070-23663092 TGACTAGGGAGGACATCGTCTGG + Intronic
1094631530 12:32180231-32180253 GGTCCAGGCAGGAAATCCTCTGG - Intronic
1097824161 12:64157541-64157563 TTTCCAGGAAGAACAATGTCAGG - Exonic
1100908812 12:99334627-99334649 TCTCTAGGGAGGAAAACGTCTGG - Intronic
1105266651 13:18824863-18824885 TGTCCAGGCAAGACAAGTCCAGG - Intergenic
1105547379 13:21360718-21360740 TGTCCAGTCATGAGAACTTCTGG + Intergenic
1106386647 13:29291808-29291830 TGTCAAGGCAGGACATAGTTGGG + Intronic
1106566184 13:30886619-30886641 TCTCCAGGGAGGACACCTTCTGG + Intergenic
1108065739 13:46576026-46576048 TGTCCAGGCAGGACACAGGGAGG - Intronic
1114740337 14:25090430-25090452 TGTCCTGGCAGCACAACCACAGG + Intergenic
1114965758 14:27957262-27957284 TGGCCATGCAGGACAATGTTGGG - Intergenic
1119260009 14:73232423-73232445 TGTGGAGGCAGGACAATGCCTGG - Intergenic
1121412220 14:93756111-93756133 TGTCCAGGCTGGTCAACTCCTGG + Intronic
1121978105 14:98424915-98424937 TGTACAGGAAGGACCACGTAAGG - Intergenic
1122542211 14:102504918-102504940 TGGCCAGGCAGGACACAGGCTGG - Exonic
1122694676 14:103546894-103546916 GGCCCAGGCAGGACCACTTCTGG + Intergenic
1202831876 14_GL000009v2_random:43225-43247 TGTCCAGGCAAGACAAGTCCAGG + Intergenic
1128493955 15:68180304-68180326 TGCCCAGGCTGGGCAACTTCTGG + Intronic
1130048407 15:80463784-80463806 TGGCCAGGCTGGCCAACCTCAGG + Intronic
1130076872 15:80696501-80696523 AGTGCGGGCAGGACAATGTCTGG + Intronic
1130307672 15:82725474-82725496 TGTCCTGGCAGGAAAACATCAGG + Intergenic
1133760783 16:8796937-8796959 TATCCAGGGAGGACAAACTCTGG + Intronic
1134763424 16:16734359-16734381 TGTCCTGGCATGCCAACGTGAGG - Intergenic
1134982628 16:18624798-18624820 TGTCCTGGCATGCCAACGTGAGG + Intergenic
1135526861 16:23219850-23219872 CATCCAGGCAGGACAAAGCCAGG + Intergenic
1139766883 16:69238080-69238102 TGTCCACGCAGGTCAGCGTCCGG - Intronic
1141947450 16:87320346-87320368 TCTGCAGTCAGGACAACTTCAGG + Intronic
1142584186 17:960540-960562 TGTCCAGCCTGGACAACATGGGG - Intronic
1146797887 17:35795574-35795596 TGCCCGGGCTGGACGACGTCTGG - Exonic
1148093310 17:45035537-45035559 TGAACAGGCAGGGCAAGGTCAGG + Intronic
1148119773 17:45201606-45201628 TGTCCAGGCAGAATTATGTCAGG + Intergenic
1149819085 17:59757616-59757638 TGGCCAGGCAGGAGTATGTCTGG - Intronic
1151669585 17:75564662-75564684 AGTCCAGCCTGGACAACGTAGGG + Intronic
1153520675 18:5950532-5950554 GGTCCTGGAAGGACAACATCTGG + Intergenic
1154421761 18:14236608-14236630 TGTCCAGGCAAGACAAGTCCAGG + Intergenic
1155982609 18:32196579-32196601 TGTCCAGGAAGCACAGCGACAGG + Intronic
1158455534 18:57603982-57604004 TGCCTAGGCAGGACAATGGCAGG - Intronic
1158879629 18:61764874-61764896 TATCCAGGCAGTAAAACCTCAGG - Intergenic
1159850007 18:73516063-73516085 TGTCCAGGCAGGACTACAAATGG + Intergenic
1159943467 18:74426341-74426363 TGTCCGGGGAGGAGAGCGTCTGG - Intergenic
1160585863 18:79913049-79913071 TGTCCAGCCAGGACATGGGCTGG - Intronic
1161038340 19:2097395-2097417 CGTCGAGGCAGGAGAAGGTCAGG - Intronic
1163726912 19:18928254-18928276 CGTCCACCCAGGACACCGTCTGG + Exonic
1165326871 19:35119058-35119080 TGTCCAGTGAGGACAACAGCGGG + Intronic
1167113148 19:47473655-47473677 AGTCCTGGCTGGACACCGTCAGG + Intergenic
1202640811 1_KI270706v1_random:84527-84549 TGTCCAGGCAAGACAAGTCCAGG - Intergenic
927499316 2:23571673-23571695 TATCCAGTCACGACAATGTCTGG - Intronic
928744981 2:34401847-34401869 ACACCAGGCAGGACAATGTCAGG + Intergenic
930053223 2:47233175-47233197 TGTACAGGAAGGTCAAGGTCTGG + Intergenic
930999874 2:57766560-57766582 TGTTCTGGCAGGAAAACATCAGG - Intergenic
931157143 2:59647950-59647972 TTTCCAGTAAGGACAACTTCTGG - Intergenic
934496373 2:94804508-94804530 TGTCCAGGCAAGACAAGTCCAGG - Intergenic
940252208 2:151691286-151691308 TGACCAGTCAGGCCAAGGTCAGG - Intronic
945473546 2:210255016-210255038 TGTCCAGGCAGGAAAATAACAGG + Intergenic
948590990 2:239050029-239050051 TCTGCAGGCGGGACCACGTCAGG - Exonic
1169200245 20:3705811-3705833 TGTCCTGGCAGGACCACGGCCGG - Exonic
1169341566 20:4800425-4800447 TGGCCAGGAAGTCCAACGTCAGG + Intronic
1170019236 20:11817316-11817338 TGCCCAGGCAGAGCAACCTCTGG + Intergenic
1171188418 20:23140578-23140600 TGTCCATCCTGGACAAAGTCTGG + Intergenic
1171887689 20:30671276-30671298 TGTCCAGGCAAGACAAGTCCAGG - Intergenic
1175260767 20:57672810-57672832 GATCCAGGCAGGACAGCGCCAGG - Intronic
1175367158 20:58463699-58463721 AGTCCAGGCAGGACAGCCACAGG + Intronic
1175438559 20:58973331-58973353 TGGCCGGGCAGAACAACGTTAGG - Intergenic
1176335053 21:5588787-5588809 TGTTCACTCAGGACATCGTCAGG - Intergenic
1176392704 21:6232161-6232183 TGTTCACTCAGGACATCGTCAGG + Intergenic
1176468715 21:7084013-7084035 TGTTCACTCAGGACATCGTCAGG - Intronic
1176492276 21:7465791-7465813 TGTTCACTCAGGACATCGTCAGG - Intergenic
1176508366 21:7672592-7672614 TGTTCACTCAGGACATCGTCAGG + Intergenic
1176851719 21:13923352-13923374 TGTCCAGGCAAGACAAGTCCAGG - Intergenic
1178736906 21:35160729-35160751 TGTCCACATAGGACAACATCCGG + Intronic
1179571985 21:42283743-42283765 TGTCCAGGCAGGACAGAGGTGGG - Intronic
1180361142 22:11897335-11897357 TGTCCAGGCAAGACAAGTCCAGG + Intergenic
1181439134 22:22926810-22926832 GGGCCAGGCAGGACTAGGTCTGG - Intergenic
1183486412 22:38089524-38089546 TGTCCAGGCAGGTGGGCGTCAGG + Exonic
1184761538 22:46547485-46547507 TGTGCAGGGAGGACTCCGTCAGG + Intergenic
950526418 3:13526751-13526773 TGCCCAGGCGGGACATAGTCAGG + Intergenic
954994664 3:54870585-54870607 TGTCCAGACACAAGAACGTCCGG + Intronic
961749228 3:129085836-129085858 TGCCCAGGCAGGACCAGGTCAGG + Intergenic
961756170 3:129128449-129128471 GGCCCAGGCAGGACCAGGTCAGG - Intronic
962890905 3:139672235-139672257 TGTCAAGGCAGGACAGAGCCCGG - Intronic
963797661 3:149647384-149647406 TGCCCAGGCAGGGCATCCTCAGG + Intronic
1202737745 3_GL000221v1_random:22860-22882 TGTCCAGGCAAGACAAGTCCAGG + Intergenic
970004008 4:11393708-11393730 CCTCCAGGCAGGACAACCTCTGG - Exonic
973384327 4:49495059-49495081 TGTCCAGGCAAGACAAGTCCAGG - Intergenic
1202768177 4_GL000008v2_random:170382-170404 TGTCCAGGCAAGACAAGTCCAGG - Intergenic
986494763 5:8331431-8331453 TGTCCAGGCATGATAACTTCAGG - Intergenic
987389268 5:17360728-17360750 AGACCAGGCAGCACAAGGTCTGG + Intergenic
991006281 5:61831421-61831443 TGTTCTGGCAGGAAAACATCAGG + Intergenic
998968174 5:147563213-147563235 AGTCCAGGCTGGGCAACATCAGG - Intergenic
1007960575 6:45955403-45955425 TGTCCACGCAGGGCAATGCCTGG + Intronic
1013432310 6:110066035-110066057 AGACAAGGCAGGAGAACGTCAGG + Intergenic
1015924020 6:138291930-138291952 TGTCCATCCAGGACCTCGTCCGG + Exonic
1020127176 7:5539419-5539441 AGGCCAGGCAGGAGAGCGTCAGG - Intronic
1021279823 7:18703955-18703977 AGTCAAGGCAGGACAAGGTCAGG - Intronic
1026630463 7:72033500-72033522 TGTTAAGGCAGGACAAAGTCAGG + Intronic
1027218303 7:76198241-76198263 TTCCCAGGCAGGTCAAGGTCTGG - Intergenic
1035309125 7:157953602-157953624 TGTCCAAGCAGGGCAGTGTCAGG - Intronic
1036728110 8:11238367-11238389 TGTCCAGGCAGGAGAAGGTATGG + Intergenic
1040568167 8:48585175-48585197 TGTCCAGAGAGGAAAACGTAAGG - Intergenic
1047174422 8:122527039-122527061 TGTTCAGGCAGGACCAGGACAGG - Intergenic
1049978105 9:878959-878981 TGGCCAGGCAGCACAACTTCAGG - Intronic
1053660770 9:40275939-40275961 TGTCCAGGCAAGACAAGTCCAGG + Intronic
1054361773 9:64128835-64128857 TGTCCAGGCAAGACAAGTCCAGG + Intergenic
1054372892 9:64422155-64422177 TGTCCAGGCAAGACAAGTCCAGG + Intergenic
1054523840 9:66100345-66100367 TGTCCAGGCAAGACAAGTCCAGG - Intergenic
1054680522 9:67911932-67911954 TGTCCAGGCAAGACAAGTCCAGG + Intergenic
1057693551 9:97307922-97307944 GGTCCAGGCGGGACGACGTCTGG - Intronic
1059429676 9:114242284-114242306 TGCACAGGCAGGGCAACATCTGG + Intronic
1062066974 9:134533878-134533900 TGTCTACCCAGGACCACGTCCGG - Intergenic
1203706473 Un_KI270742v1:53304-53326 TGTCCAGGCAAGACAAGTCCAGG + Intergenic
1188737193 X:33732405-33732427 TGTCCAGCCAGGATAACCTAGGG + Intergenic
1189439141 X:41018830-41018852 TCTCCAGGCAGGCCAGCCTCTGG - Intergenic
1192207457 X:69105851-69105873 TCTCCAGGCAGGCCAACTTGTGG + Intergenic
1201990326 Y:20016715-20016737 TGTCCAGGCAGGAGACACTCAGG + Intergenic