ID: 1074533185

View in Genome Browser
Species Human (GRCh38)
Location 10:114310838-114310860
Sequence CATGACCTCTGAAAAGCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 231}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074533185_1074533187 10 Left 1074533185 10:114310838-114310860 CCTCTGGCTTTTCAGAGGTCATG 0: 1
1: 0
2: 2
3: 13
4: 231
Right 1074533187 10:114310871-114310893 TGGAGTCTCCACGCTGCCTGAGG No data
1074533185_1074533186 -10 Left 1074533185 10:114310838-114310860 CCTCTGGCTTTTCAGAGGTCATG 0: 1
1: 0
2: 2
3: 13
4: 231
Right 1074533186 10:114310851-114310873 AGAGGTCATGCAACTCTCTGTGG No data
1074533185_1074533188 16 Left 1074533185 10:114310838-114310860 CCTCTGGCTTTTCAGAGGTCATG 0: 1
1: 0
2: 2
3: 13
4: 231
Right 1074533188 10:114310877-114310899 CTCCACGCTGCCTGAGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074533185 Original CRISPR CATGACCTCTGAAAAGCCAG AGG (reversed) Intronic
900525517 1:3126541-3126563 GATGAGCTTTGAAAACCCAGGGG + Intronic
901124937 1:6922600-6922622 CATGTCCTGAGAAAAGCCGGTGG + Intronic
901701249 1:11045744-11045766 CATCACCTCTGTTAAACCAGTGG + Intronic
907949255 1:59165104-59165126 TATTACCTTTGAAAAGCCAATGG + Intergenic
908782449 1:67703700-67703722 CATGGCCTTAGAAAAGCGAGGGG + Exonic
911290408 1:96050699-96050721 CATAGCCTCTGATAAGGCAGTGG + Intergenic
912515586 1:110214806-110214828 GATGACATCAGAAAACCCAGGGG + Intronic
912861100 1:113214671-113214693 CCTGAACTCTGCAAAGCCATAGG - Intergenic
917223050 1:172752147-172752169 CATGAGCTTTGAAAAGCTATTGG + Intergenic
919125592 1:193388941-193388963 CATAAGCAATGAAAAGCCAGTGG - Intergenic
920684882 1:208101825-208101847 CATGACCACTGCAGAGCTAGAGG + Intronic
920736011 1:208533703-208533725 AATGACCTGTGAGAAGCCAAGGG - Intergenic
920775354 1:208931404-208931426 CATGCTCTGTGAAAAGACAGAGG - Intergenic
921530951 1:216282292-216282314 CATGTCCTCGGATTAGCCAGTGG - Intronic
921919472 1:220650198-220650220 CATGCCCACTCAGAAGCCAGTGG - Intronic
922076915 1:222254040-222254062 CATGACCCCTGAAGCCCCAGAGG - Intergenic
1063091853 10:2872649-2872671 CATCACCACGGAACAGCCAGGGG + Intergenic
1066749790 10:38642392-38642414 CATCATCTCTTAAAAGTCAGTGG - Intergenic
1066966858 10:42275384-42275406 CATCATCTCTTAAAAGTCAGTGG + Intergenic
1067061968 10:43082226-43082248 CTTGGCCCCTGAAAAGCCTGGGG + Intronic
1067437906 10:46291892-46291914 CATGACCTCGGATGATCCAGTGG + Intronic
1068059593 10:52050654-52050676 CATGAGCTCATAAAATCCAGGGG - Intronic
1069779903 10:70948675-70948697 CATGACCTCTGAGAGACCACTGG - Intergenic
1069994382 10:72333578-72333600 CATGACTTAGGAAAAACCAGTGG + Exonic
1070153643 10:73820156-73820178 CAGGACATCAGAAAAGACAGAGG - Intronic
1071667659 10:87576562-87576584 CATGACCCCTGAAGTCCCAGAGG - Intergenic
1072062607 10:91830078-91830100 CATTACCTCTGCAAAATCAGTGG - Intronic
1072702832 10:97656428-97656450 CATGACCCTTGATAAGCCAGAGG - Intronic
1074533185 10:114310838-114310860 CATGACCTCTGAAAAGCCAGAGG - Intronic
1076197947 10:128533654-128533676 CATGACCTCTGAAAACTCCCTGG + Intergenic
1076319206 10:129565862-129565884 CAGGACCTCTGGAAACTCAGGGG - Intronic
1077343197 11:2035154-2035176 CATGTTCTCTGAGGAGCCAGGGG - Intergenic
1079124914 11:17712069-17712091 AAGGACTCCTGAAAAGCCAGAGG - Intergenic
1079818620 11:25094929-25094951 CATGATTTCTGTTAAGCCAGTGG - Intergenic
1080902535 11:36509877-36509899 CCTGACCTGTGAAAAGCGAAGGG + Intronic
1082040210 11:47678696-47678718 CAAGACCTCAGAAAGGCCATAGG + Intronic
1082096885 11:48138188-48138210 ACTCACCACTGAAAAGCCAGAGG - Intronic
1084547477 11:69821648-69821670 CATTACCTCTGCAAAGCCTCTGG + Intergenic
1084725291 11:70937871-70937893 TGTGACCTCTCAGAAGCCAGAGG + Intronic
1085190006 11:74611826-74611848 CATCAACTGTGAAAAGACAGTGG + Intronic
1087938503 11:104063917-104063939 CAGGACCACTGGAAAGCCAACGG + Intronic
1088506881 11:110535597-110535619 CATGCTTTCTGTAAAGCCAGTGG - Intergenic
1089651941 11:119920287-119920309 CATGAGCTCAGAACAGCCCGTGG - Intergenic
1090420537 11:126572273-126572295 CAAGATCTTTGCAAAGCCAGAGG + Intronic
1202826183 11_KI270721v1_random:90343-90365 CATGTTCTCTGAGGAGCCAGGGG - Intergenic
1092531316 12:9347965-9347987 CATGGCCTATGAACAGCCAAAGG + Intergenic
1094120475 12:26968861-26968883 AATGACCTCTGGAAAGACAGAGG - Intergenic
1095285904 12:40409769-40409791 CATGACCCCAGGAAGGCCAGAGG + Intronic
1096050820 12:48606038-48606060 GATAACCTCTGCAAAGCCACAGG - Intergenic
1101709104 12:107248499-107248521 CATGGCATCTGAGAAGCCAAGGG - Intergenic
1105074052 12:133259898-133259920 CATGCCTTCTGAACAGCCTGCGG - Intergenic
1105658868 13:22470989-22471011 CATACACTCTGAAAAGCAAGAGG + Intergenic
1107795954 13:44052012-44052034 CAGGGCCTCAGAAAACCCAGAGG - Intergenic
1111527820 13:89494600-89494622 CTTTACCTCTGAAAAGAGAGAGG - Intergenic
1113273553 13:108702254-108702276 CATAAACTGTGAAAAGCCAAAGG + Intronic
1113328676 13:109308256-109308278 CAAGACCTGGGAAAACCCAGAGG - Intergenic
1115121447 14:29942129-29942151 GCTGACCCCTGAAAAGCCACAGG + Intronic
1116859104 14:49979388-49979410 CATCAGCTCTGAAAGGCCTGGGG - Intergenic
1119200140 14:72746216-72746238 CATCACCTCTGGGAAGACAGTGG + Intronic
1120564609 14:86039072-86039094 CATGAGCTTTGAGAGGCCAGGGG + Intergenic
1122179190 14:99943379-99943401 CATGGCATCAGAAGAGCCAGAGG + Intergenic
1122239730 14:100355015-100355037 CTTGACCTCTGAACTCCCAGAGG - Intronic
1124499245 15:30212271-30212293 AATGGCCTGTGAAAAGGCAGGGG - Intergenic
1124744334 15:32326399-32326421 AATGGCCTGTGAAAAGGCAGGGG + Intergenic
1124953313 15:34343071-34343093 CATGATCGCTTATAAGCCAGCGG + Exonic
1125108332 15:36000657-36000679 CATGACCTCAAAAAAGCCATTGG - Intergenic
1125408748 15:39382825-39382847 AATAACCTCTGAAAAGTCATTGG - Intergenic
1128237121 15:66075879-66075901 CAGGACCTCTGAAGAGGAAGAGG + Intronic
1130285995 15:82555084-82555106 CAGGACCTCTGAAGAGCCAGTGG + Intronic
1130670745 15:85910396-85910418 AAAGAACTCTGAAGAGCCAGAGG - Intergenic
1130828729 15:87577581-87577603 CATGACCTCTGAAACCAGAGAGG - Intergenic
1132042795 15:98538986-98539008 CAGGATCTCTGCAAAGCCTGCGG - Intergenic
1133575325 16:7083488-7083510 CATGGCCTCTGATACACCAGTGG - Intronic
1133594653 16:7279917-7279939 TATGACCTTTGAGAAACCAGTGG + Intronic
1134350218 16:13430517-13430539 CATTACGTCTGAAAACCCACCGG - Intergenic
1137547726 16:49415970-49415992 AATCACCTCTGAAAAGTCGGTGG + Intergenic
1137603806 16:49774143-49774165 CCTGACTTCTGCAAAGCCACAGG - Intronic
1139124931 16:64066491-64066513 CATGTGTTCTGAAAAGCCACTGG + Intergenic
1141939957 16:87269035-87269057 CATGAGCTCTGATAGGACAGTGG - Intronic
1148802120 17:50235844-50235866 CATGGCCCATGAAAAGCCCGAGG + Intergenic
1151178667 17:72310013-72310035 CCTGACCTCTGTGAATCCAGTGG + Intergenic
1151351446 17:73534435-73534457 CCTGACCTCTGAGAGGCCTGGGG + Intronic
1151817072 17:76476640-76476662 CATGACCTGGGAAGGGCCAGGGG - Intronic
1152943504 17:83185452-83185474 CATCATCTCTGCAAAGCCAAGGG - Intergenic
1153042408 18:826303-826325 CAAGAGCTTTGAAAAGGCAGTGG + Intergenic
1153546831 18:6215994-6216016 CATAACCTCTGAGAAGGCAAAGG + Intronic
1154974866 18:21447659-21447681 CATGACAGCTGAAAAGCAGGTGG - Intronic
1155683737 18:28521156-28521178 CATGACCTCTGGAGCCCCAGAGG - Intergenic
1157960832 18:52151775-52151797 CATGACCTCTTACCAGTCAGAGG + Intergenic
1159623186 18:70662752-70662774 CATGCCCTATCAGAAGCCAGAGG - Intergenic
1159712285 18:71775867-71775889 TATGAACTCAGAATAGCCAGGGG + Intronic
1160529279 18:79554086-79554108 CATGACCTCGGGCAGGCCAGGGG - Intergenic
1161008764 19:1949856-1949878 CATGCCGTCTAGAAAGCCAGGGG + Intronic
1161868596 19:6853164-6853186 TATGACCTCTGCAAGGCCATTGG - Intronic
1162606866 19:11715760-11715782 CATGACCTCTAAACAGCTACTGG + Intergenic
1167641468 19:50685009-50685031 CATGACCCCCTAAAAGCCAAAGG + Intronic
1167683078 19:50937642-50937664 CATCTCCTCAGAAAAACCAGTGG - Intergenic
1167998558 19:53426320-53426342 CACCACTTCAGAAAAGCCAGGGG - Intronic
1168008680 19:53512431-53512453 CACCACTTCAGAAAAGCCAGGGG - Intergenic
927018022 2:18987768-18987790 AATGAATTCTGAAAAGCAAGTGG - Intergenic
927079519 2:19613717-19613739 CATGACCTGTGGAAAACCACTGG - Intergenic
928675420 2:33646323-33646345 GATGACTTCTGGAATGCCAGTGG - Intergenic
929962351 2:46506309-46506331 CAGGACCTCAGAGAAGGCAGGGG - Intronic
930012528 2:46948246-46948268 CTTTGCCTCTGTAAAGCCAGGGG - Intronic
930695723 2:54409970-54409992 CATGACCTTAGAGAAGGCAGAGG - Intergenic
931575778 2:63717033-63717055 TATGACCTCTGGAGAGGCAGTGG + Intronic
932144020 2:69303291-69303313 AATGCCCACTTAAAAGCCAGGGG - Intergenic
932940826 2:76162694-76162716 CATGAACTCTGAAAATCCTTAGG + Intergenic
933134199 2:78711203-78711225 CATCATCTCTGGGAAGCCAGTGG - Intergenic
936456894 2:112682150-112682172 CATTACCTTTGCAAAGCCACTGG + Intergenic
937207256 2:120244764-120244786 TATGACCTCTGGTTAGCCAGAGG + Intronic
937645025 2:124257112-124257134 CATGATCTCTGAAAACCCCAGGG - Intronic
942380963 2:175390139-175390161 CATGACCTCAAGACAGCCAGAGG + Intergenic
944144338 2:196490023-196490045 TATGACCACTGCAAAGCAAGAGG + Intronic
945178570 2:207068216-207068238 CATGGCTTCTGAGAAGCCAAGGG + Intergenic
948357678 2:237393011-237393033 GGAGACCTCTGAAGAGCCAGAGG - Intronic
1169021917 20:2336540-2336562 CCTGACCTCAGAAAGGGCAGGGG + Intronic
1169474728 20:5920767-5920789 CTTTGCCTCTTAAAAGCCAGTGG - Intronic
1170278858 20:14623685-14623707 CATCATCCCTGAAAAGCCAGTGG + Intronic
1170951678 20:20942052-20942074 CATGCTCTGTGAAAAGGCAGGGG + Intergenic
1171252599 20:23660704-23660726 CATCACCCCTGACAAGCCAAAGG + Intergenic
1172428457 20:34872089-34872111 CATGACCTCTCAAAAGTCCTTGG - Intronic
1175502995 20:59463551-59463573 AGGGACCTCTCAAAAGCCAGGGG + Intergenic
1175606850 20:60318196-60318218 CTTGAACTCTTAAAAGGCAGGGG - Intergenic
1175812891 20:61868341-61868363 CAGGACCTCTGAGGAGTCAGAGG + Intronic
1176170631 20:63694934-63694956 CCTGACCACTGCAAAGCCAGAGG + Exonic
1177026598 21:15928224-15928246 GCTGCCCTCTGAAATGCCAGGGG + Intergenic
1178582338 21:33847420-33847442 CCTGCCCTTTGAAAAGCCGGTGG + Intronic
1179474073 21:41632174-41632196 CATGACCTGGGAAGAGGCAGGGG + Intergenic
1181086406 22:20441565-20441587 CATGGGGTCTGAAAACCCAGCGG + Exonic
1181095045 22:20499057-20499079 CCTGATCTCTGAATAGCCAGTGG + Intronic
1181712672 22:24700432-24700454 CTAGACTTCTGAAAAGACAGGGG + Intergenic
1183194060 22:36341187-36341209 CATGTCCTCTGGATAGCCACTGG + Intronic
1184289145 22:43489072-43489094 CCTAACCTCTGAAACACCAGGGG + Intronic
949631250 3:5929196-5929218 CATGACCGCTGAAGCCCCAGAGG - Intergenic
953377974 3:42444790-42444812 CATGCCCTTGGAAAAGCCACAGG + Intergenic
954686468 3:52372833-52372855 CAGGTCCTCTGAGAATCCAGGGG - Intronic
954749988 3:52808031-52808053 CATCAACCCTGAAAGGCCAGTGG + Intronic
954976834 3:54704007-54704029 CTTGATCTTTGAAAAGCAAGTGG + Intronic
955195052 3:56797626-56797648 AATGCCAGCTGAAAAGCCAGAGG - Intronic
957402552 3:79735080-79735102 CATTACCTCTGAAAAAGCATAGG + Intronic
957586409 3:82138117-82138139 AATGAACTCTTAAAAACCAGAGG - Intergenic
958962764 3:100525771-100525793 CACAAGCTCTGAAAAGTCAGGGG - Intronic
959390299 3:105764184-105764206 CAGGACCTCTATAAATCCAGGGG + Intronic
959632139 3:108518679-108518701 CATGACGTGTGAACACCCAGAGG - Intronic
961406268 3:126681941-126681963 AATGACCACTGAAAACTCAGAGG + Intergenic
964310296 3:155385152-155385174 CCTGGCCTCTGAAACTCCAGAGG - Intronic
964669509 3:159209591-159209613 CATGACCTCTGGAGCCCCAGAGG - Intronic
966790382 3:183663460-183663482 TATCACCTCAGAATAGCCAGTGG - Exonic
966881995 3:184355703-184355725 CATGAACTGTCCAAAGCCAGGGG + Exonic
970315466 4:14824894-14824916 CATGACCTAGGCAAAGACAGAGG + Intergenic
971787469 4:31123569-31123591 CATGACCTCTGGAGCCCCAGAGG + Intronic
971841441 4:31857520-31857542 CATGACCTATGAAAAGACACAGG + Intergenic
972911455 4:43822314-43822336 GGTGAACCCTGAAAAGCCAGAGG - Intergenic
973257508 4:48128137-48128159 CCTGACATCGGAAATGCCAGGGG - Intronic
974844558 4:67335592-67335614 CATGGGCTTTGAAAAGACAGGGG + Intergenic
976094416 4:81492379-81492401 TATAAGCTCTGAAAAGCAAGGGG + Intronic
976473454 4:85455708-85455730 CATGACCCCTGAAGCCCCAGAGG - Intergenic
976653265 4:87459128-87459150 CATGTCCTCTGAAAAGACATGGG + Intronic
978852456 4:113355016-113355038 AATGACCTCAGAGAAGTCAGTGG - Exonic
981271545 4:142851447-142851469 AATGACCTCAGAAGAGTCAGTGG + Intergenic
981681729 4:147407397-147407419 CAAGACCTAGGAAAAGCCTGAGG + Intergenic
982506078 4:156219196-156219218 GATGAACCCTGAAAAGCCACAGG + Intergenic
983825509 4:172253405-172253427 CATGACTGATGTAAAGCCAGGGG + Intronic
985621124 5:956679-956701 CAGGACCTCGGAAGGGCCAGGGG + Intergenic
986559565 5:9046854-9046876 CCTGACCACTGAAGTGCCAGTGG + Intronic
987055178 5:14184354-14184376 CATGGCCTCTGTACAGCCATGGG + Intronic
988606785 5:32685324-32685346 CATGAGATTTGAGAAGCCAGAGG + Intergenic
988848432 5:35154195-35154217 AAAGACCTCTGAGAAGTCAGAGG + Intronic
989558727 5:42826939-42826961 CATGGCCTCTGAAAAACAACAGG + Intronic
990079809 5:51899260-51899282 CATGACCTCTGGAGCCCCAGAGG + Intergenic
990343492 5:54848728-54848750 CATTATCTCTGAAAGGCCTGTGG + Intergenic
991409439 5:66331830-66331852 CATGTACCCTGCAAAGCCAGGGG + Intergenic
991903688 5:71486689-71486711 CATGAACTCTCAAAGGCCTGAGG - Intronic
992174389 5:74135065-74135087 CATGTGCTATCAAAAGCCAGAGG - Intergenic
992420311 5:76597312-76597334 CATGAACTCTGAAAAGCTGCAGG - Intronic
992610420 5:78503761-78503783 AATGACTGCTGAAAAGCAAGTGG - Intronic
993005819 5:82426973-82426995 CGTGGCCTCTGATGAGCCAGAGG - Intergenic
994333624 5:98538104-98538126 CATGAAAACTGAAAAGACAGTGG + Intergenic
995353404 5:111209369-111209391 CATACTCTCTGATAAGCCAGAGG + Intergenic
997777973 5:136628896-136628918 CATGAACTCAGAAAAGCTTGGGG - Intergenic
998454088 5:142257294-142257316 CAGGACCTCAGAGAAGGCAGAGG - Intergenic
999393516 5:151211954-151211976 CATGACCTCTGAGGAGGAAGTGG - Intronic
1002326869 5:178415526-178415548 CCTGACCTCTCCACAGCCAGAGG + Intronic
1003885826 6:10520647-10520669 CCTGGCCTAGGAAAAGCCAGAGG + Intronic
1005594995 6:27370573-27370595 CATGACCACAGAAACGCCACAGG + Intergenic
1009524577 6:64728201-64728223 CATGACCCCTGAAGCCCCAGAGG + Intronic
1010094074 6:72018966-72018988 CAGGTCATCTAAAAAGCCAGTGG - Intronic
1013341972 6:109223804-109223826 CATTACCTCTGGAAATGCAGGGG - Intergenic
1014635595 6:123843076-123843098 CATGACCTCTGGAGCCCCAGAGG + Intronic
1014762953 6:125377941-125377963 AATGACATCTGGAAAGCAAGAGG + Intergenic
1014940755 6:127436012-127436034 CATGAGCTCTGTAAGTCCAGCGG - Intergenic
1015187598 6:130435958-130435980 GATTACCTGTGAAAAGCCATGGG - Intronic
1015888373 6:137944369-137944391 AATGAGCTATGAAAACCCAGCGG + Intergenic
1017415627 6:154217309-154217331 CATGAGCTCTGAAAGTACAGTGG - Intronic
1017480132 6:154845222-154845244 CATGAGCTCTGAAAGGACAGTGG + Intronic
1019209428 6:170393315-170393337 CATGGCCTCTGAAATGAAAGAGG - Intronic
1019423747 7:963535-963557 CATCCACTCTGAAGAGCCAGGGG - Intronic
1020569255 7:9837774-9837796 AATGACATTTGAAAAGACAGTGG + Intergenic
1021073625 7:16273778-16273800 CATGACCCCTGAAGCCCCAGAGG - Intronic
1021380102 7:19956022-19956044 TATGCACTCTGAAAAGCCACAGG + Intergenic
1022819846 7:33948747-33948769 CATGCCTTCTGTACAGCCAGAGG + Intronic
1028973647 7:96888166-96888188 CATGAGCTCTGAAAACCCAAGGG + Intergenic
1031712620 7:125068028-125068050 CATGACCTCTGGAGTCCCAGAGG + Intergenic
1031959941 7:127979857-127979879 CATGAGCTCTGTAAAATCAGTGG + Intronic
1033063407 7:138129232-138129254 GATGAACTCTGCAAAGCCACAGG - Intergenic
1033599339 7:142877458-142877480 CCTGCCCCCTGAAATGCCAGGGG - Intronic
1033630947 7:143157197-143157219 CATGACCTCTGTAATTCCATAGG + Intergenic
1034023489 7:147670952-147670974 CATGACCCCTGAAGCTCCAGAGG - Intronic
1034685656 7:152968611-152968633 CATGACTTCTGAGCAGCAAGGGG - Intergenic
1035044336 7:155953925-155953947 AAAGACCTCGGAAAAGCCAGAGG - Intergenic
1038513633 8:28164184-28164206 TATGACCTCAGGCAAGCCAGGGG - Intronic
1039474748 8:37833752-37833774 CATCATGTCTGAAAAGCTAGCGG - Exonic
1040035205 8:42863297-42863319 CATGTCCTATGAAAAGCCATGGG + Intronic
1040688980 8:49911431-49911453 CAGGGCCACTGAAAAGTCAGGGG + Intronic
1041408764 8:57530497-57530519 CATTACCTCTCAAAACCCTGAGG - Intergenic
1043147471 8:76676466-76676488 TCTGACCTCTGAAAGACCAGAGG + Intergenic
1043222728 8:77687275-77687297 GCTGACCTCTGCAAAGCCACAGG + Intergenic
1044154811 8:88831581-88831603 AATGACCTCTGTTAAACCAGGGG + Intergenic
1044375263 8:91462812-91462834 CATGACCTAAGAATAGCAAGCGG + Intergenic
1045735201 8:105287969-105287991 CATGAGCTCTGTAAATCCTGTGG + Intronic
1046175526 8:110570860-110570882 CATGCACTCGGAAAAGCCACAGG - Intergenic
1047359250 8:124152780-124152802 CAACACATCTCAAAAGCCAGGGG - Intergenic
1047545601 8:125813575-125813597 CAAGACCTCTGACATGCCATGGG - Intergenic
1047741443 8:127810084-127810106 CATGCCCTCTGGAAAGGGAGAGG + Intergenic
1047768480 8:128010637-128010659 CATGGCTTCTTAAAAGTCAGAGG - Intergenic
1048781193 8:138003770-138003792 CATGCCCTCTGTACAGCCTGTGG + Intergenic
1050059118 9:1687222-1687244 CATGACCCCTGGAACCCCAGAGG + Intergenic
1051662394 9:19437991-19438013 CATTACCTCTGAAAAGTCAAAGG + Intronic
1054810428 9:69429840-69429862 CATGACCTCAGTAGAGACAGGGG - Exonic
1055866756 9:80823635-80823657 CATGACCTTTGCAAAGACATGGG + Intergenic
1056684546 9:88748742-88748764 CAGGGCCTCTGAGAAGCCAAAGG - Intergenic
1057006794 9:91567974-91567996 CATGACCCCTGAAGCCCCAGAGG + Intronic
1059599581 9:115762176-115762198 CATGTTCTCTGAGAAACCAGAGG + Intergenic
1060004211 9:119985378-119985400 CATGACCTATCACCAGCCAGGGG - Intergenic
1062529750 9:136994602-136994624 CCTGACATCTGAAGGGCCAGAGG - Intergenic
1186033184 X:5392045-5392067 CATGACTTCTGAAGCCCCAGAGG + Intergenic
1186039636 X:5461791-5461813 CAAGACCAATGAAAAGACAGGGG + Intergenic
1187306349 X:18098784-18098806 CACGAACTCTGACAAGGCAGAGG - Intergenic
1192634757 X:72806537-72806559 CTGGACCTCTGAAGAACCAGAGG + Intronic
1192646956 X:72914264-72914286 CTGGACCTCTGAAGAACCAGAGG - Intronic
1193226022 X:78985383-78985405 CATGACCCTGGAAAAGCCACAGG - Intergenic
1194638233 X:96371978-96372000 CATAACCTCAGAAAAGCTAAGGG + Intergenic
1195858613 X:109357282-109357304 CTTGATCTCTGAAAAGCCAGTGG + Intergenic
1197053258 X:122086612-122086634 CATGAGCTCTAATAAGGCAGAGG + Intergenic
1197513590 X:127398894-127398916 CATGCCCTCTCAAATACCAGAGG + Intergenic
1197539233 X:127734762-127734784 CATGATCTCTGATAAGTCAAAGG - Intergenic