ID: 1074533337

View in Genome Browser
Species Human (GRCh38)
Location 10:114311664-114311686
Sequence TACACGGATGGCCCTGCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074533332_1074533337 -4 Left 1074533332 10:114311645-114311667 CCTATTAGCTTGGGCCAAATACA 0: 1
1: 0
2: 0
3: 6
4: 153
Right 1074533337 10:114311664-114311686 TACACGGATGGCCCTGCCCAGGG No data
1074533331_1074533337 -3 Left 1074533331 10:114311644-114311666 CCCTATTAGCTTGGGCCAAATAC 0: 1
1: 0
2: 0
3: 6
4: 78
Right 1074533337 10:114311664-114311686 TACACGGATGGCCCTGCCCAGGG No data
1074533325_1074533337 28 Left 1074533325 10:114311613-114311635 CCCAGCACAGGGCAGGCACATGG 0: 1
1: 1
2: 6
3: 82
4: 636
Right 1074533337 10:114311664-114311686 TACACGGATGGCCCTGCCCAGGG No data
1074533330_1074533337 1 Left 1074533330 10:114311640-114311662 CCATCCCTATTAGCTTGGGCCAA 0: 1
1: 0
2: 0
3: 5
4: 92
Right 1074533337 10:114311664-114311686 TACACGGATGGCCCTGCCCAGGG No data
1074533327_1074533337 27 Left 1074533327 10:114311614-114311636 CCAGCACAGGGCAGGCACATGGA 0: 1
1: 0
2: 4
3: 38
4: 342
Right 1074533337 10:114311664-114311686 TACACGGATGGCCCTGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074533337 Original CRISPR TACACGGATGGCCCTGCCCA GGG Intronic
No off target data available for this crispr