ID: 1074534597

View in Genome Browser
Species Human (GRCh38)
Location 10:114319865-114319887
Sequence AGTAGTCACATGGTCATCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074534597_1074534602 -3 Left 1074534597 10:114319865-114319887 CCAGAGATGACCATGTGACTACT No data
Right 1074534602 10:114319885-114319907 ACTTGTCACCAAGGGACTGTGGG No data
1074534597_1074534601 -4 Left 1074534597 10:114319865-114319887 CCAGAGATGACCATGTGACTACT No data
Right 1074534601 10:114319884-114319906 TACTTGTCACCAAGGGACTGTGG No data
1074534597_1074534604 22 Left 1074534597 10:114319865-114319887 CCAGAGATGACCATGTGACTACT No data
Right 1074534604 10:114319910-114319932 GAAGTGATGTGCGTGACTTCCGG No data
1074534597_1074534605 26 Left 1074534597 10:114319865-114319887 CCAGAGATGACCATGTGACTACT No data
Right 1074534605 10:114319914-114319936 TGATGTGCGTGACTTCCGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074534597 Original CRISPR AGTAGTCACATGGTCATCTC TGG (reversed) Intronic