ID: 1074534598 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:114319875-114319897 |
| Sequence | CTTGGTGACAAGTAGTCACA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1074534598_1074534604 | 12 | Left | 1074534598 | 10:114319875-114319897 | CCATGTGACTACTTGTCACCAAG | No data | ||
| Right | 1074534604 | 10:114319910-114319932 | GAAGTGATGTGCGTGACTTCCGG | No data | ||||
| 1074534598_1074534605 | 16 | Left | 1074534598 | 10:114319875-114319897 | CCATGTGACTACTTGTCACCAAG | No data | ||
| Right | 1074534605 | 10:114319914-114319936 | TGATGTGCGTGACTTCCGGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1074534598 | Original CRISPR | CTTGGTGACAAGTAGTCACA TGG (reversed) | Intronic | ||