ID: 1074534603

View in Genome Browser
Species Human (GRCh38)
Location 10:114319893-114319915
Sequence CACTTCTGCCCACAGTCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074534603_1074534609 21 Left 1074534603 10:114319893-114319915 CCAAGGGACTGTGGGCAGAAGTG No data
Right 1074534609 10:114319937-114319959 TGCTGTTAAGAAGCAGATAGGGG No data
1074534603_1074534607 19 Left 1074534603 10:114319893-114319915 CCAAGGGACTGTGGGCAGAAGTG No data
Right 1074534607 10:114319935-114319957 GGTGCTGTTAAGAAGCAGATAGG No data
1074534603_1074534608 20 Left 1074534603 10:114319893-114319915 CCAAGGGACTGTGGGCAGAAGTG No data
Right 1074534608 10:114319936-114319958 GTGCTGTTAAGAAGCAGATAGGG No data
1074534603_1074534605 -2 Left 1074534603 10:114319893-114319915 CCAAGGGACTGTGGGCAGAAGTG No data
Right 1074534605 10:114319914-114319936 TGATGTGCGTGACTTCCGGCTGG No data
1074534603_1074534604 -6 Left 1074534603 10:114319893-114319915 CCAAGGGACTGTGGGCAGAAGTG No data
Right 1074534604 10:114319910-114319932 GAAGTGATGTGCGTGACTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074534603 Original CRISPR CACTTCTGCCCACAGTCCCT TGG (reversed) Intronic