ID: 1074534604

View in Genome Browser
Species Human (GRCh38)
Location 10:114319910-114319932
Sequence GAAGTGATGTGCGTGACTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074534603_1074534604 -6 Left 1074534603 10:114319893-114319915 CCAAGGGACTGTGGGCAGAAGTG No data
Right 1074534604 10:114319910-114319932 GAAGTGATGTGCGTGACTTCCGG No data
1074534597_1074534604 22 Left 1074534597 10:114319865-114319887 CCAGAGATGACCATGTGACTACT No data
Right 1074534604 10:114319910-114319932 GAAGTGATGTGCGTGACTTCCGG No data
1074534598_1074534604 12 Left 1074534598 10:114319875-114319897 CCATGTGACTACTTGTCACCAAG No data
Right 1074534604 10:114319910-114319932 GAAGTGATGTGCGTGACTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074534604 Original CRISPR GAAGTGATGTGCGTGACTTC CGG Intronic