ID: 1074534604 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:114319910-114319932 |
| Sequence | GAAGTGATGTGCGTGACTTC CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1074534603_1074534604 | -6 | Left | 1074534603 | 10:114319893-114319915 | CCAAGGGACTGTGGGCAGAAGTG | No data | ||
| Right | 1074534604 | 10:114319910-114319932 | GAAGTGATGTGCGTGACTTCCGG | No data | ||||
| 1074534597_1074534604 | 22 | Left | 1074534597 | 10:114319865-114319887 | CCAGAGATGACCATGTGACTACT | No data | ||
| Right | 1074534604 | 10:114319910-114319932 | GAAGTGATGTGCGTGACTTCCGG | No data | ||||
| 1074534598_1074534604 | 12 | Left | 1074534598 | 10:114319875-114319897 | CCATGTGACTACTTGTCACCAAG | No data | ||
| Right | 1074534604 | 10:114319910-114319932 | GAAGTGATGTGCGTGACTTCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1074534604 | Original CRISPR | GAAGTGATGTGCGTGACTTC CGG | Intronic | ||