ID: 1074534609

View in Genome Browser
Species Human (GRCh38)
Location 10:114319937-114319959
Sequence TGCTGTTAAGAAGCAGATAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074534603_1074534609 21 Left 1074534603 10:114319893-114319915 CCAAGGGACTGTGGGCAGAAGTG No data
Right 1074534609 10:114319937-114319959 TGCTGTTAAGAAGCAGATAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074534609 Original CRISPR TGCTGTTAAGAAGCAGATAG GGG Intronic