ID: 1074536442

View in Genome Browser
Species Human (GRCh38)
Location 10:114331621-114331643
Sequence CAAGCAAATCACCTGTAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1466
Summary {0: 1, 1: 0, 2: 1, 3: 81, 4: 1383}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074536433_1074536442 10 Left 1074536433 10:114331588-114331610 CCATCACCCTCAGCATCCGGAGT 0: 1
1: 0
2: 4
3: 219
4: 4207
Right 1074536442 10:114331621-114331643 CAAGCAAATCACCTGTAGGCAGG 0: 1
1: 0
2: 1
3: 81
4: 1383
1074536428_1074536442 18 Left 1074536428 10:114331580-114331602 CCCCAGACCCATCACCCTCAGCA No data
Right 1074536442 10:114331621-114331643 CAAGCAAATCACCTGTAGGCAGG 0: 1
1: 0
2: 1
3: 81
4: 1383
1074536434_1074536442 4 Left 1074536434 10:114331594-114331616 CCCTCAGCATCCGGAGTACTGTG 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1074536442 10:114331621-114331643 CAAGCAAATCACCTGTAGGCAGG 0: 1
1: 0
2: 1
3: 81
4: 1383
1074536435_1074536442 3 Left 1074536435 10:114331595-114331617 CCTCAGCATCCGGAGTACTGTGG 0: 1
1: 0
2: 0
3: 51
4: 1240
Right 1074536442 10:114331621-114331643 CAAGCAAATCACCTGTAGGCAGG 0: 1
1: 0
2: 1
3: 81
4: 1383
1074536432_1074536442 11 Left 1074536432 10:114331587-114331609 CCCATCACCCTCAGCATCCGGAG 0: 1
1: 0
2: 0
3: 17
4: 204
Right 1074536442 10:114331621-114331643 CAAGCAAATCACCTGTAGGCAGG 0: 1
1: 0
2: 1
3: 81
4: 1383
1074536429_1074536442 17 Left 1074536429 10:114331581-114331603 CCCAGACCCATCACCCTCAGCAT 0: 1
1: 0
2: 2
3: 24
4: 267
Right 1074536442 10:114331621-114331643 CAAGCAAATCACCTGTAGGCAGG 0: 1
1: 0
2: 1
3: 81
4: 1383
1074536430_1074536442 16 Left 1074536430 10:114331582-114331604 CCAGACCCATCACCCTCAGCATC 0: 1
1: 0
2: 4
3: 45
4: 448
Right 1074536442 10:114331621-114331643 CAAGCAAATCACCTGTAGGCAGG 0: 1
1: 0
2: 1
3: 81
4: 1383
1074536437_1074536442 -6 Left 1074536437 10:114331604-114331626 CCGGAGTACTGTGGCCCCAAGCA 0: 1
1: 0
2: 1
3: 9
4: 151
Right 1074536442 10:114331621-114331643 CAAGCAAATCACCTGTAGGCAGG 0: 1
1: 0
2: 1
3: 81
4: 1383

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074536442 Original CRISPR CAAGCAAATCACCTGTAGGC AGG Intronic
900015645 1:147214-147236 CAGGCAAATCACCTGAAGTCTGG + Intergenic
900045908 1:505809-505831 CAGGCAAATCACCTGAAGTCTGG + Intergenic
900068110 1:747520-747542 CAGGCAAATCACCTGAAGTCTGG + Intergenic
900194009 1:1364806-1364828 CAGGCAAATCACCTGAGGTCAGG + Intergenic
900272772 1:1801253-1801275 CAAGCAGATCACCTGAGGCCAGG - Intronic
900277320 1:1839617-1839639 CAGGCAAATCACCTGAGGTCAGG + Intronic
900336715 1:2167830-2167852 CAAGCAGATCACCTGAGGTCAGG - Intronic
900593473 1:3469937-3469959 CAAGCTGCTCACCTGTAGGCAGG + Intronic
900849579 1:5131475-5131497 CCGGCAGATCACCTGTAGTCAGG + Intergenic
900886215 1:5417368-5417390 CAGGCAGATCACCTGAAGTCAGG + Intergenic
901265556 1:7907936-7907958 CAAGCAGATCACCTGAGGTCAGG + Intergenic
901306870 1:8239264-8239286 CAAGCAGATCACCTGAGGTCAGG - Intergenic
901314794 1:8299302-8299324 CAGGCAGATCACCTGAAGTCAGG - Intergenic
901389530 1:8934997-8935019 CAGGCAGATCACCTGCAGTCAGG - Intergenic
901520686 1:9782777-9782799 CAAGCAGATCACCTGAGGTCAGG + Intronic
901568560 1:10139953-10139975 CAGGCAAATCACCTGAGGTCAGG - Intronic
901744795 1:11365213-11365235 TAAGCAGATCACCTGAAGTCAGG + Intergenic
901746748 1:11378772-11378794 CAAGCAGATCACCTGCGGTCAGG + Intergenic
901847798 1:11995403-11995425 CAGGCAAATCACCTGAGGTCAGG + Intronic
902042102 1:13500021-13500043 CAGGCAGATCACCTGAGGGCAGG + Intronic
902061810 1:13650224-13650246 CAGGCAAATCACCTGAGGTCAGG - Intergenic
902106409 1:14039940-14039962 CATGCATATCACCCTTAGGCTGG + Intergenic
902314720 1:15609498-15609520 CAGGCAAATCACTTGAAGCCAGG - Intergenic
902321715 1:15672321-15672343 CAAGCAGATCACCTGAGGTCAGG + Intergenic
902327446 1:15710945-15710967 CAAGCAGATCACCTGAGGTCTGG + Intronic
902370394 1:16003252-16003274 CAAGCAGATCACCTGAGGTCAGG + Intergenic
902944028 1:19821198-19821220 CAAGCAGATCACCTGAGGTCAGG - Intergenic
902976662 1:20093459-20093481 CAGGCAGATCACCTGAAGTCAGG - Intergenic
903047619 1:20576069-20576091 CAGGCAAATCACCTGAGGTCAGG + Intergenic
903132202 1:21287296-21287318 CAGGCAGATCACCTGAGGGCAGG + Intronic
903251879 1:22060112-22060134 CAGGCAGATCACCTGAGGGCTGG + Intronic
903784174 1:25846494-25846516 CGAGCAGATCACCTGTGGTCAGG + Intronic
903785852 1:25860789-25860811 CAGGCATATCACCTGAGGGCAGG - Intergenic
903825297 1:26140469-26140491 CAAGCAGATCACCTGAGGTCAGG + Intergenic
904095883 1:27976943-27976965 CAGGCAAATCACCTGAGGTCAGG - Intronic
904204821 1:28847277-28847299 CAGGCAGATCACCTGAAGTCAGG - Intronic
904212139 1:28893027-28893049 CAGGCAAATCACTTGAAGCCAGG - Intronic
904292008 1:29492632-29492654 CAGACAAATCACCTGAAGTCAGG + Intergenic
904525235 1:31128589-31128611 CAGGCAAATCACCTGAGGTCAGG - Intergenic
904535165 1:31194632-31194654 CAGGCAAATCACCTGAGGTCGGG - Intronic
904640191 1:31920763-31920785 CAAGCGAATCACCTGAGGTCAGG - Intronic
904666092 1:32122726-32122748 CAGGCAAATCACCTGAGGCCAGG + Intronic
904694218 1:32318889-32318911 CAAGCAGATCACCTGGGGTCGGG + Intronic
904757631 1:32777254-32777276 CAGGCAGATCACCTGAGGGCGGG - Intronic
904775240 1:32902042-32902064 CAAGCAGATCACCTGAGGTCAGG + Intergenic
905119908 1:35673694-35673716 CAGGCAAATCACCTGAGGTCAGG - Intergenic
905197369 1:36290691-36290713 CAGGCAGATCACCTGAAGTCAGG - Intronic
905563959 1:38948468-38948490 CAAGCAGATCACCTGATGTCAGG + Intergenic
905665021 1:39758452-39758474 CAGGCAGATCACCTGAAGTCAGG - Exonic
905734979 1:40318524-40318546 CAGGCAGATCACCTGAAGTCAGG - Intergenic
905761461 1:40561769-40561791 CAAGCAGATCACCTGAGGACGGG - Intergenic
905937643 1:41837551-41837573 CAAGCAGATCACCTGAGGTCGGG - Intronic
906081687 1:43094219-43094241 CAAGCAGATCACCTGAGGTCAGG - Intergenic
906213851 1:44027746-44027768 CAGGCAAATCACCTGAGGTCAGG + Intronic
906754681 1:48299284-48299306 CGAGCAAATCACCTGAGGTCGGG + Intronic
906765554 1:48428225-48428247 CAGGCAGATCACCTGAAGTCAGG + Intronic
906981063 1:50629829-50629851 CAGGCAGATCACCTGAAGTCAGG + Intronic
907193937 1:52671170-52671192 CAGGCAAATCACCTGAGGCCAGG + Intergenic
907213141 1:52840198-52840220 CAAGTGAATCACCTGAAGTCGGG - Intergenic
907215220 1:52858012-52858034 CAAGCAGATCACCTGAGGTCAGG - Intronic
907656757 1:56351053-56351075 CAAGCAGATCACCTGCGGTCAGG + Intergenic
908153468 1:61328644-61328666 CAGGCAAATCACCTGAGGTCGGG - Intronic
908456026 1:64305997-64306019 CAGGCAAATCACCTGAGGTCAGG + Intergenic
909195893 1:72622747-72622769 CAGGCAGATCACCTGAAGTCAGG - Intergenic
909407716 1:75311342-75311364 CCAGCAGATCACCTGAAGTCAGG - Intronic
909714680 1:78693687-78693709 CAGGCAAATCACCTGAGGTCAGG - Intergenic
909905299 1:81186885-81186907 CAGGCAAATCACCTGAGGTCAGG + Intergenic
909955321 1:81772020-81772042 CAGGCAGATCACCTGTGGTCAGG + Intronic
910183781 1:84513360-84513382 CAGGCAGATCACCTGTGGTCGGG - Intergenic
910246073 1:85139709-85139731 CAGGCAGATCACCTGAAGTCAGG + Intergenic
910977712 1:92924734-92924756 CCAGCAAATCTTCTGTCGGCAGG + Intronic
911206862 1:95100345-95100367 CAGGCAAATCACCTGAGGTCAGG + Intergenic
911347917 1:96720103-96720125 CAAGCAGATCACCTGAGGTCGGG - Intergenic
911403771 1:97409848-97409870 CAAGCGGATCACCTGAAGTCAGG + Intronic
911716009 1:101133970-101133992 CAGGCAAATCACCTGAGGCCAGG - Intergenic
912054829 1:105581675-105581697 CAAGCAGATCACCTGAGGTCAGG - Intergenic
912811887 1:112801250-112801272 CAAGCAGATCACCTGAGGTCAGG + Intergenic
912851285 1:113127457-113127479 CAAGCAGATCACCTGAGGTCAGG - Exonic
912997138 1:114541994-114542016 CAGGCAGATCACCTGAAGTCAGG + Intergenic
913005240 1:114623961-114623983 CAGGCAGATCACCTGAAGTCAGG - Intronic
913101461 1:115571562-115571584 CAGGCAAATCACCTGAGGTCAGG + Intergenic
913111561 1:115661843-115661865 CAGGCAAATCACCTGAGGTCAGG - Intronic
913544243 1:119851546-119851568 CAGGCAGATCACCTGAAGTCAGG + Intergenic
914259167 1:145984560-145984582 CAGGCAAATCACCTGAGGTCAGG - Intergenic
914732877 1:150387815-150387837 CAGGCAAATCACCTGAGGTCAGG - Intronic
914735938 1:150416640-150416662 CAGGCAGATCACCTGAAGTCAGG + Intronic
914757131 1:150569503-150569525 CAAGCAGATCACCTGAGGTCAGG - Intergenic
914820898 1:151102091-151102113 CAGGCAGATCACCTGAAGTCAGG + Intronic
914865317 1:151422817-151422839 CAGGCAGATCACCTGAAGTCAGG - Intronic
915209694 1:154298969-154298991 CAAGCAGATCACCTGAGGTCAGG + Intergenic
915223926 1:154397575-154397597 CAAGCGGATCACCTGAGGGCAGG - Intergenic
915523593 1:156463071-156463093 CAGGCAGATCACCTGAAGTCAGG - Intergenic
915537078 1:156543264-156543286 CAGGCAAAGCCCCTGTGGGCAGG + Intronic
915720537 1:157981932-157981954 CAAGCAATTCTCCTGTAGCTGGG - Intergenic
916179833 1:162073686-162073708 CAGGCAGATCACCTGAAGTCGGG - Intronic
916410629 1:164543573-164543595 CAAGCAGATCACTTGAAGTCAGG - Intergenic
916726624 1:167529226-167529248 CAGGCAGATCACCTGAAGTCAGG - Intergenic
917122840 1:171659469-171659491 CAGGCAGATCACCTGAAGTCAGG + Intergenic
917370245 1:174285242-174285264 CAGGCAGATCACCTGAAGTCAGG - Intronic
917514545 1:175696650-175696672 CAGGCAGATCACCTGTGGTCGGG + Intronic
917764904 1:178205230-178205252 CAGGCAAATCACCTGAGGTCAGG - Intronic
917812660 1:178674686-178674708 CAAGCAGATCACCTGAGGTCAGG - Intergenic
917862684 1:179162355-179162377 CAGGCAGATCACCTGAAGTCAGG + Intronic
917897437 1:179505423-179505445 CAAGCAGATCACCTGAGGTCGGG + Intronic
917945963 1:179971254-179971276 CAGGCAGATCACCTGCAGTCAGG - Intronic
917953571 1:180067459-180067481 CAGGCAGATCACCTGTGGTCAGG + Intronic
918039422 1:180903860-180903882 CAAGCAGATCACCTGAGGTCAGG - Intergenic
918300586 1:183200161-183200183 CAGGCAAATCACCTGAGGTCAGG + Intronic
918512465 1:185326140-185326162 AAAGAAAATCACTTCTAGGCTGG - Intergenic
918664498 1:187133006-187133028 CAGGCAAATCACCTGAGGTCAGG - Intergenic
918681955 1:187367035-187367057 CAGGCAGATCACCTGAAGTCGGG - Intergenic
918748444 1:188238493-188238515 CAGGCAAATCACCTGAGGTCAGG + Intergenic
918845417 1:189603017-189603039 CAGGCAAATCACCTGAGGCCAGG - Intergenic
919163143 1:193857986-193858008 CAGGCAGATCACCTGAAGTCAGG + Intergenic
919740430 1:200977959-200977981 CAGGCAAATCACCTGAGGTCGGG - Intronic
919992005 1:202714069-202714091 CAAGCAGATCACCTGAGGTCAGG + Intergenic
919993170 1:202723261-202723283 CAAGCAGATCACTTGTGGTCAGG + Intergenic
919998876 1:202779576-202779598 CAAGCAGATCACCTGAGGTCAGG + Intronic
920016991 1:202920084-202920106 CAGGCAAATCACCTGAGGTCAGG + Intronic
920767574 1:208848147-208848169 CAAGCAGATCACCTGAGGTCAGG + Intergenic
920836657 1:209517342-209517364 AGAGCAAATCACCTGTCAGCAGG + Intergenic
920876859 1:209844401-209844423 CAGGCGAATCACCTGTGGTCAGG + Intronic
920901036 1:210110969-210110991 CAGGCAGATCACCTGAAGTCGGG - Intronic
921112474 1:212052407-212052429 CAGGCAGATCACCTGAAGTCAGG + Intronic
921328905 1:214015883-214015905 CTAGTCATTCACCTGTAGGCAGG + Intronic
921380422 1:214519039-214519061 CAAGCAGATCACCTGAGGTCAGG + Intronic
921456554 1:215379178-215379200 CCAGGAAAGCACCTCTAGGCAGG - Intergenic
921635696 1:217489633-217489655 CAAGCAGATCACCTGAGGTCAGG + Intronic
921637204 1:217510863-217510885 CGGGCAAATCACCTGCAGTCAGG + Intronic
921914405 1:220590982-220591004 CAAGAAAAAGACGTGTAGGCAGG - Intronic
922263793 1:223965419-223965441 CAGGCAAATCACCTGAAGTCTGG + Intergenic
922281355 1:224127677-224127699 CAGGCAAATCACCTGAGGCCAGG + Intronic
922292767 1:224222347-224222369 CAGGCAAATCACCTGAGGTCAGG - Intergenic
922409880 1:225362345-225362367 CAGGCAGATCACCTGAAGTCAGG + Intronic
922527302 1:226314775-226314797 CAAGCAGATCACCTGAGGTCGGG + Intergenic
922643534 1:227261341-227261363 CAGGCAGATCACCTGAAGTCAGG - Intronic
922819788 1:228476392-228476414 CAGGCAGATCACCTGAAGTCGGG - Intergenic
923023270 1:230183748-230183770 CAGGCAGATCACCTGAAGTCAGG + Intronic
923395276 1:233555638-233555660 CGGGCAAATCACCTGAAGTCAGG - Intergenic
923561278 1:235043737-235043759 CAAGCAGATCACCTGAGGTCAGG + Intergenic
923610989 1:235493548-235493570 CAAGCAGATCACCTGAGGTCAGG + Intronic
923667975 1:236015417-236015439 CAGGCAAATCACCTGAGGCCAGG + Intronic
923890550 1:238210785-238210807 CAAGCAGATCACCTGAGGTCAGG + Intergenic
924142738 1:241042710-241042732 CAGGCAGATCACCTGTGGTCAGG + Intronic
924345638 1:243070413-243070435 CAGGCAAATCACCTGAAGCCTGG + Intergenic
1062973148 10:1663843-1663865 CAAGCAGATCACCTGAAGCCAGG - Intronic
1063495238 10:6501592-6501614 CAGGCAGATCACCTGAAGTCGGG + Intronic
1063517913 10:6714402-6714424 CAGGCAGATCACCTGTGGTCAGG - Intergenic
1063560180 10:7118885-7118907 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1063579552 10:7293324-7293346 CAGGCAGATCACCTGAAGTCAGG - Intronic
1063922149 10:10943827-10943849 CAAGCAGATCACCTGAGGTCAGG - Intergenic
1064007626 10:11711135-11711157 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1064017314 10:11782580-11782602 CAGGCAGATCACCTGTGGTCAGG - Intergenic
1064134674 10:12740369-12740391 CAGGCGAATCACCTGAGGGCAGG + Intronic
1064180077 10:13107145-13107167 CCAGCAGATCACCTGAAGTCAGG + Intronic
1064548882 10:16478559-16478581 CAGGCAAATCACCTGAGGTCAGG - Intronic
1064804084 10:19110890-19110912 CAAGGAAATCACCTATTGGCTGG + Intronic
1065302538 10:24336011-24336033 CAGGCAAATCACCTGAGGTCAGG + Intronic
1065461811 10:25974974-25974996 CAAGCTAGCCATCTGTAGGCTGG + Intronic
1065544370 10:26804153-26804175 CAAGCAGATCACCTGGGGTCAGG + Intronic
1065991588 10:31015414-31015436 CAAGCAGATCACCTGAGGTCAGG + Intronic
1066364234 10:34761181-34761203 CAGGCAAATCACTTGAAGTCAGG + Intronic
1066475487 10:35743184-35743206 CAAGCAGATCACCTGAGGTCAGG - Intergenic
1066559970 10:36659678-36659700 CAGGCAAATCACCTGAGGTCAGG - Intergenic
1066663203 10:37756469-37756491 CAGGCAGATCACCTGAAGTCGGG + Intergenic
1066692307 10:38042407-38042429 CAGGCAGATCACCTGTGGTCAGG - Intronic
1066730702 10:38434402-38434424 CAGGCAAATCACCTGAAGTCTGG - Intergenic
1067102733 10:43344610-43344632 CAGGAAAATCACCTGAAGCCAGG + Intergenic
1067496787 10:46767917-46767939 CAGGCAAATCACCTAAAGTCAGG - Intergenic
1067597866 10:47572486-47572508 CAGGCAAATCACCTAAAGTCAGG + Intergenic
1068443137 10:57085656-57085678 CGAGCAGATCACCTGAAGTCAGG + Intergenic
1068789285 10:61009484-61009506 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1068829246 10:61473849-61473871 CAAGCAGATCACTTGAAGTCAGG - Intergenic
1069037710 10:63662893-63662915 CAAGCAGATCACCTGAGGTCAGG - Intergenic
1069289389 10:66758705-66758727 CAGGCAGATCACCTGAAGTCAGG + Intronic
1069404340 10:68082237-68082259 CAGGCAAATCACCTGAGGTCAGG + Intergenic
1069436299 10:68387127-68387149 CAGGCAGATCACCTGAAGTCAGG + Intronic
1069460086 10:68586403-68586425 CAAGCAGATCACCTGAGGTCAGG - Intronic
1069559671 10:69420604-69420626 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1069652919 10:70064139-70064161 CAGGCAGATCACCTGAAGTCAGG + Intronic
1069679209 10:70271887-70271909 CAAGCAGATCACCTGAGGTCAGG + Intronic
1069948520 10:72003470-72003492 CAAGCAGATCACCTGAGGTCAGG + Intronic
1069977080 10:72222547-72222569 CAGGCAAATCACCTGAGGTCAGG + Intronic
1070120412 10:73570908-73570930 CAGGCAGATCACCTGAAGTCAGG + Intronic
1070269832 10:74942536-74942558 CAAGCAGATCACCTGAGGTCAGG + Intronic
1070275040 10:74997882-74997904 CAAGCAGATCACCTGAGGTCAGG + Intronic
1070754689 10:78984722-78984744 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1072368982 10:94744749-94744771 CAGGCAGATCACCTGAAGTCGGG + Intronic
1072558499 10:96545660-96545682 CGAGCAGATCACCTGAAGTCAGG + Intronic
1072673367 10:97447692-97447714 CAAGCACATCACCTGAGGTCGGG + Intronic
1072703822 10:97665499-97665521 CAGGCAGATCACCTGAAGTCAGG - Intronic
1072709835 10:97708970-97708992 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1072858012 10:98970188-98970210 CAGGCAGATCACCTGAAGCCAGG - Intronic
1072918818 10:99558308-99558330 CAAGCAGATCACCTGAGGTCAGG + Intergenic
1074238192 10:111607558-111607580 CAGGCAAATCACCTGAGGTCAGG - Intergenic
1074369814 10:112891169-112891191 CAAGCAGATCACTTGAAGCCAGG - Intergenic
1074536442 10:114331621-114331643 CAAGCAAATCACCTGTAGGCAGG + Intronic
1074891338 10:117738938-117738960 CGAGCAGATCACCTGAAGCCAGG - Intergenic
1075323464 10:121511030-121511052 CAGGCAGATCACCTGCAGTCAGG - Intronic
1075396584 10:122132316-122132338 CATGCAGATCACCTGAAGTCAGG + Intronic
1075515994 10:123108738-123108760 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1075814656 10:125255588-125255610 CGAGCAGATCACCTGAAGTCAGG + Intergenic
1075986378 10:126789041-126789063 CAGGCAAATCACCTGAGGTCAGG + Intergenic
1076533854 10:131163288-131163310 TAAACAAATCTCCTGCAGGCAGG + Intronic
1076742205 10:132491799-132491821 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1076972236 11:142280-142302 CAGGCAAATCACCTGAAGTCTGG + Intergenic
1077120715 11:906799-906821 CAGGCAGATCACCTGAAGTCGGG + Intronic
1078156328 11:8803155-8803177 CAAGCAGATCACTTGAGGGCAGG + Intronic
1078260170 11:9698630-9698652 CAGGCAGATCACCTGAAGTCAGG - Intronic
1078274190 11:9827063-9827085 CAAGCAGATCACCTGAGGTCAGG - Intronic
1078581186 11:12540899-12540921 CAAGCATCTTACCTTTAGGCAGG + Intergenic
1078655081 11:13231118-13231140 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1078799161 11:14625219-14625241 CAGGCAGATCACCTGAAGTCAGG + Intronic
1078827745 11:14946824-14946846 CAAGCAGATCACCTGAGGTCAGG + Intronic
1079050887 11:17158120-17158142 CAGGCAAATCACCTGAGGTCGGG + Intronic
1079201420 11:18380457-18380479 CAGGCAAATCACCTGATGTCAGG + Intergenic
1079759287 11:24309197-24309219 CAAGCGAAGGACCTGGAGGCAGG + Intergenic
1079918533 11:26401647-26401669 CAAGCAAATCACTTGAGGTCAGG + Intronic
1080365415 11:31568855-31568877 CAGGCAGATCACCTGAAGTCAGG + Intronic
1080522619 11:33080589-33080611 CGAGCAAATCACCTGAGGTCAGG - Intronic
1080795540 11:35559712-35559734 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1081040857 11:38210110-38210132 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1081681118 11:45003990-45004012 CCAGCAAATCACCTGAGGGCAGG - Intergenic
1081971071 11:47199129-47199151 CAGGCAAATCACCTGAAGTCAGG + Intergenic
1082055094 11:47808053-47808075 CAGGCAAATCACCTGAGGTCAGG + Intronic
1082277749 11:50239853-50239875 CAAGCAGATCACCTGAAGTCAGG - Intergenic
1082801551 11:57418660-57418682 CAAGCAGATCACCTGAGGCCAGG + Intronic
1082927702 11:58568373-58568395 CAGGCAAATCACCTGAGGTCAGG + Intronic
1083035655 11:59635058-59635080 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1083192765 11:61064341-61064363 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1083252408 11:61477040-61477062 CAGGCAGATCACCTGAAGTCAGG - Intronic
1083286745 11:61664552-61664574 CAAGCAGATCACCTGAGGTCAGG + Intergenic
1083386463 11:62313872-62313894 TTAGCAAATCACCTTTAGGCAGG - Intergenic
1083447565 11:62719220-62719242 CGGGCAAATCACCTGAAGTCAGG + Intronic
1083468825 11:62868147-62868169 CAGGCAGATCACCTGAAGTCAGG - Intronic
1083541981 11:63517814-63517836 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1083914657 11:65733515-65733537 CAAGCAGATCACCTGAGGTCAGG + Intergenic
1084011904 11:66355940-66355962 CAAGAAAATCACTTGAACGCGGG - Intronic
1084026018 11:66450160-66450182 CAGGCAAATCACCTGAGGTCAGG + Intronic
1084135264 11:67174028-67174050 CAGGCAAATCACCTGAAGTCAGG + Intronic
1084300652 11:68249226-68249248 CAGGCAAATCACCTGAGGTCAGG - Intergenic
1084339157 11:68482156-68482178 CAAGCAGATCACCTGAGGTCAGG + Intronic
1084733914 11:71092303-71092325 CAAACAAAATACCTGAAGGCAGG + Intronic
1085092847 11:73733319-73733341 CAGGCAGATCACCTGAAGTCAGG + Intronic
1085095474 11:73756899-73756921 CAGGCAAATCACCTGAGGTCAGG - Intronic
1085168306 11:74424775-74424797 CAGGCAGATCACCTGTGGTCAGG - Intergenic
1085607923 11:77919511-77919533 CAGGCAGATCACCTGTGGTCAGG - Intronic
1085837833 11:79975171-79975193 CAAGCAGATCACCTGAGGTCAGG - Intergenic
1085881055 11:80466275-80466297 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1086513485 11:87586250-87586272 CAGGCAAATCACCTGAAGTCAGG - Intergenic
1086723420 11:90149663-90149685 CAAGCAGATCACCTGAGGTCGGG - Intronic
1086805817 11:91240767-91240789 CAAGCAAATCACCTAAGGTCAGG + Intergenic
1086893154 11:92282131-92282153 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1087045395 11:93840018-93840040 CCAGCAAACCACCTGAAGCCAGG + Intronic
1087475568 11:98629618-98629640 CAAGCAGATCACCTGAGGTCAGG - Intergenic
1087623976 11:100574466-100574488 CAGGCAAATCACCTGAGGTCAGG + Intergenic
1087625335 11:100589173-100589195 CAGGCAAATCACCTGAGGTCAGG + Intergenic
1087775947 11:102256705-102256727 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1088288739 11:108213044-108213066 CCAGCAAATCACCTGAGGTCGGG + Intronic
1088366564 11:109046264-109046286 CAGGCAAATCACCTGGGGTCAGG - Intergenic
1088753827 11:112868606-112868628 CAAGCAGATCACTTGAAGCCAGG - Intergenic
1089444711 11:118542683-118542705 CAGGCAGATCACCTAAAGGCAGG + Intronic
1089486542 11:118851018-118851040 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1089501604 11:118935021-118935043 CAGGCAAATCACCTGAGGTCAGG + Intronic
1089776296 11:120839012-120839034 CAGGCAGATCACCTGAAGTCAGG - Intronic
1089914329 11:122138117-122138139 CAAGCAGATCACCTGAGGTCAGG + Intergenic
1089935700 11:122361853-122361875 CAAGCAGATCACCTGAGGTCAGG - Intergenic
1089976237 11:122734112-122734134 CAGGCAGATCACCTGAAGTCAGG - Intronic
1090015983 11:123086964-123086986 CAAGCAGATCACTTGAAGTCAGG + Intronic
1090141937 11:124274816-124274838 CAAGCAGATCACCTGAGGTCAGG + Intergenic
1090166830 11:124558293-124558315 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1090405549 11:126474029-126474051 CAAGCAGATCACCTGAGGTCAGG - Intronic
1090791864 11:130097022-130097044 CAAGCAGATCTGCTGTAAGCTGG + Intronic
1090998815 11:131891141-131891163 CAAGCTAATCCCTTGTAGGGAGG + Intronic
1091513904 12:1158678-1158700 CAGGCAAATCACCTGAGGACGGG - Intronic
1091517875 12:1203283-1203305 CAAGCAGATCACCTGAGGTCAGG - Intronic
1091809091 12:3379969-3379991 CATGGGAATCACCTGCAGGCTGG - Intergenic
1091899441 12:4133264-4133286 CATGGGAATCACCTGTGGGCAGG + Intergenic
1092397497 12:8141099-8141121 CAGGCAGATCACCTGAGGGCAGG - Intronic
1092842267 12:12553968-12553990 CAAGCAGATCACTTGAAGTCAGG + Intronic
1093105261 12:15078857-15078879 CAGGCAGATCACCTGAAGTCGGG + Intergenic
1093704680 12:22261354-22261376 CAGGCAGATCACCTGAAGTCTGG - Intronic
1094115792 12:26911060-26911082 CAAGCAGATCACCTGAGGTCAGG - Intronic
1094231781 12:28113932-28113954 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1094579681 12:31722927-31722949 CAAGCAGATCACCTGAAGTCAGG + Intronic
1094772138 12:33675446-33675468 CAAGCAAATCACTTGAGGTCAGG + Intergenic
1095586437 12:43854862-43854884 CAGGCAGATCACCTGAAGTCAGG - Intronic
1095956097 12:47807165-47807187 CAGGCAAATCACCTGAGGACAGG - Intronic
1095957626 12:47815836-47815858 CAGGCAGATCACTTGAAGGCAGG - Intronic
1096040560 12:48512029-48512051 TGAGCAGATCACCTGTAGTCAGG + Intronic
1096177467 12:49532378-49532400 CAGGCAAATCACCTGAGGTCAGG - Intergenic
1096367930 12:51044417-51044439 CAGGCAAATCACCTGAGGTCAGG - Intergenic
1096374498 12:51097175-51097197 CAAGCAGATCACCTGAGGTCAGG - Intronic
1096708146 12:53435936-53435958 CAGGCAGATCACCTGAAGTCGGG + Intergenic
1097019945 12:56013421-56013443 CAAGCAGATCACTTGAAGTCAGG - Intronic
1097027774 12:56070576-56070598 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1097100703 12:56587036-56587058 CAGGCAAATCACCTGAGGTCAGG + Intronic
1097672614 12:62558203-62558225 CAGGCAGATCACCTGAAGTCAGG - Intronic
1097840384 12:64315702-64315724 CAGGCAGATCACCTGAAGTCAGG + Intronic
1097844005 12:64348049-64348071 CAAGCAGATCACCTGAAGACAGG + Intronic
1097855306 12:64455211-64455233 CAGGCAGATCACCTGAAGCCAGG - Intronic
1097907608 12:64936474-64936496 CAAGAAAATAATCTGGAGGCAGG - Intergenic
1098023786 12:66181914-66181936 CATGAAAATAACCTGTAGCCAGG - Intergenic
1098166861 12:67707596-67707618 CAAGCAGATCACCTGAGGTCAGG - Intergenic
1098269102 12:68752916-68752938 CAGGCAAATCACCTGAGGTCAGG + Intronic
1098511423 12:71318577-71318599 CAGGCAGATCACCTGAAGTCAGG + Intronic
1098696867 12:73570562-73570584 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1098708234 12:73719151-73719173 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1098852186 12:75610096-75610118 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1099043539 12:77686318-77686340 CAAGCAGATCACCTGAGGTCAGG - Intergenic
1099240744 12:80135498-80135520 CAGGCAGATCACCTGAGGGCAGG - Intergenic
1099329881 12:81270601-81270623 CCAGCAAATCACCAGAAGTCAGG + Intronic
1099739397 12:86612520-86612542 CAAGCAGATCATCTGAAGTCAGG + Intronic
1099926659 12:89026956-89026978 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1099949385 12:89283849-89283871 CAGGCAGATCACTTGAAGGCAGG + Intergenic
1099960199 12:89389641-89389663 CAAGCAGATCACCTGAGGTCAGG - Intergenic
1100179927 12:92074066-92074088 CAGGCAGATCACCTGAAGCCAGG - Intronic
1100588935 12:96005973-96005995 CAAGCAGATCACTTGAAGTCAGG - Intronic
1100642216 12:96492763-96492785 CAGGCAGATCACCTGCAGTCAGG + Intronic
1100643944 12:96509586-96509608 CAAGCAGATCACCTGAGGTCAGG + Intronic
1100781370 12:98030117-98030139 CAAGCAATTATCCTGTAGCCAGG + Intergenic
1100959958 12:99951645-99951667 CAGGCAGATCACCTGAAGCCAGG + Intronic
1101097824 12:101361394-101361416 CAGGCAAATCACCTGTGGTCAGG + Intronic
1101149364 12:101870431-101870453 CAAGCAGATCACCTGAGGTCAGG - Intergenic
1101602050 12:106218788-106218810 CAAGAGAATCACCTGAATGCGGG - Intergenic
1101613398 12:106312653-106312675 CAGGCAAATCACCTGAGGTCAGG + Intronic
1101763215 12:107676152-107676174 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1101856239 12:108445620-108445642 CAGGCAAATCACCTGAGGCCAGG + Intergenic
1102037528 12:109780776-109780798 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1102073901 12:110044744-110044766 CAAGCAGATCACCTGAAGTCGGG + Intronic
1102092232 12:110201173-110201195 CGAGCAGATCACCTGAAGTCAGG + Intronic
1102249902 12:111379595-111379617 CAAGCAGATCACCTGAGGTCGGG + Intergenic
1102277279 12:111592160-111592182 CAAGCGAATCACCTGAGGTCAGG + Intronic
1102511923 12:113421762-113421784 CAAGCAGATCACCTGAGGACAGG + Intronic
1102804897 12:115771023-115771045 CAAGTAAATTACCTGTACACAGG - Intergenic
1103062878 12:117873115-117873137 CAAGCAGATCACCTGAGGTCAGG + Intronic
1103063750 12:117879917-117879939 CAGGCAGATCACCTGAAGTCAGG + Intronic
1103519515 12:121528663-121528685 CAAGCAGATCACCTGAGGTCAGG + Intronic
1103529975 12:121594356-121594378 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1103635558 12:122302327-122302349 CAGGCAAATCACCTGAGGTCAGG - Intronic
1103696583 12:122820614-122820636 CAGGCAGATCACCTGAGGGCAGG + Intronic
1103748242 12:123140756-123140778 CCAGCCATGCACCTGTAGGCTGG - Intronic
1103814608 12:123644056-123644078 CAGGCAGATCACCTGTGGTCAGG - Intronic
1104460758 12:128953971-128953993 CAGGCAAATCACCTGAGGTCAGG - Intronic
1104593420 12:130102925-130102947 CAGGCAAATCACCTGAGGTCAGG - Intergenic
1104669550 12:130670985-130671007 CAGGCAGATCACCTGAAGTCAGG - Intronic
1104840151 12:131820138-131820160 CAAGCAGATCACCTGAGGTCAGG - Intergenic
1105320465 13:19315166-19315188 TAAAAAAATTACCTGTAGGCTGG - Intergenic
1105408824 13:20152609-20152631 CAGGCAAATCACCTGAGGTCAGG - Intronic
1105519541 13:21119405-21119427 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1105573102 13:21622691-21622713 CAGGCAGATCACCTGTGGTCAGG - Intergenic
1105811382 13:23999221-23999243 CAAGAAAATCAACATTAGGCTGG - Intronic
1106718943 13:32419497-32419519 CAGGCAGATCACCTGAAGTCAGG - Intronic
1107058921 13:36134753-36134775 AAAGCAAATTACATTTAGGCAGG - Intergenic
1107338434 13:39380718-39380740 CAGGCAGATCACCTGTGGTCAGG - Intronic
1107543655 13:41416786-41416808 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1107796803 13:44061364-44061386 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1108046803 13:46391163-46391185 CAGGCAGATCACCTGTGGTCAGG - Intronic
1108094029 13:46881405-46881427 CAAGCCACTCAGCTGCAGGCTGG + Intronic
1108362158 13:49677679-49677701 CAAGCAGATCACCTGAGGTCAGG + Intronic
1108386860 13:49906953-49906975 CAGGCAAATCACCTGAGGTCGGG - Intergenic
1108594824 13:51940424-51940446 CAAGCAGATCACCTGAGGTCAGG + Intronic
1108980555 13:56507377-56507399 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1109201880 13:59440093-59440115 CAAGCGAAGCGCCTGTGGGCCGG - Intergenic
1109255306 13:60073079-60073101 CAGGCAGATCACCTGAAGTCAGG + Intronic
1109323575 13:60839196-60839218 CAGGCAGATCACCTGAAGTCGGG + Intergenic
1109628638 13:65013605-65013627 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1109868915 13:68305177-68305199 CAAGCGGATCACCTGAAGTCGGG - Intergenic
1109869018 13:68305950-68305972 CAGGCAGATCACCTGAAGTCTGG - Intergenic
1109919711 13:69040398-69040420 CAAGCAGATCACATGAAGCCAGG + Intergenic
1110383702 13:74883476-74883498 CAGGCAAATCACCTGAGGTCAGG + Intergenic
1110466788 13:75811339-75811361 TAAGAAAAGCACCGGTAGGCAGG - Intronic
1111328367 13:86730622-86730644 CAGGCAAATCACCTGAGGTCAGG - Intergenic
1111575282 13:90145241-90145263 CGGGCAAATCACCTGAAGTCAGG + Intergenic
1112179936 13:97068677-97068699 CAAGCTGATGACATGTAGGCTGG - Intergenic
1112240964 13:97680582-97680604 CAGGCAAATCACTTGAAGTCAGG - Intergenic
1112393631 13:99008459-99008481 CAAGCAGATCACCTGAGGTCAGG - Intronic
1112673146 13:101664959-101664981 CAGGCAGATCACCTGAAGTCAGG - Intronic
1113585294 13:111460397-111460419 AAAGCAAATCTGCTGCAGGCAGG - Intergenic
1114161166 14:20169385-20169407 CAAGCAAATCACCTGAAGTCAGG + Intergenic
1114243120 14:20887635-20887657 CATGCAAATCACCTGAGGTCAGG + Intergenic
1114285581 14:21239644-21239666 CGAGCAAATCACCTGAGGACAGG + Intronic
1114389525 14:22291927-22291949 CAGGCAGATCACCTGCAGTCAGG + Intergenic
1114478172 14:23012541-23012563 CAGGCAAATCACCTGAGGTCAGG + Intergenic
1114769237 14:25409898-25409920 CAGGCAGATCACCTGAGGGCCGG + Intergenic
1115213785 14:30994216-30994238 CAGGCAAATCACCTGAAGTCAGG - Intronic
1115239894 14:31243671-31243693 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1115577955 14:34729540-34729562 CAAGCACATCACTTGAGGGCAGG - Intergenic
1115596993 14:34918973-34918995 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1115600068 14:34947615-34947637 CAGGCAGATCACCTGAGGGCAGG - Intergenic
1115637424 14:35304198-35304220 CAGGCAGATCACCTGAAGTCAGG - Intronic
1115773119 14:36687178-36687200 CAGGCAAATCACCTGAGGTCAGG - Intronic
1116219820 14:42069272-42069294 CAAGCAGATCACCTGAGGTCAGG + Intergenic
1116404469 14:44551256-44551278 CAGGCAAATCACCTGAGGTCAGG + Intergenic
1116453102 14:45086166-45086188 CAGGCAGATCACCTGAAGTCAGG - Intronic
1116659012 14:47683685-47683707 CAGGCAGATCACCTGTGGTCAGG + Intergenic
1116974426 14:51099805-51099827 CAAGCAAATGATCTTTTGGCAGG - Intergenic
1117402068 14:55367513-55367535 CAAGCGGATCACCTGAAGTCAGG + Exonic
1118272200 14:64353849-64353871 CAGGCAGATCACCTGCAGTCAGG + Intergenic
1118844937 14:69540650-69540672 CAGGCAAATCACCTGAGGTCAGG - Intergenic
1118977843 14:70692877-70692899 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1119294968 14:73525654-73525676 CAAGGAAAGCACCTTTAGGCCGG + Intronic
1119362553 14:74063410-74063432 CAGGCAGATCACCTGAAGTCAGG - Intronic
1119388819 14:74276407-74276429 CAGGCAAATCACCTGAGGTCGGG - Intergenic
1119393174 14:74305102-74305124 CAGGCAAATCACCTGAGGTCAGG + Intronic
1119397585 14:74338950-74338972 CAGGCAGATCACCTGAAGTCAGG - Intronic
1119455162 14:74748924-74748946 CAAGCAGATCACCTGAGGTCGGG + Intergenic
1119516194 14:75250503-75250525 CAGGCAAATCACCTGAGGCCAGG + Intronic
1119651414 14:76386687-76386709 CAGGCAGATCACCTGAAGTCAGG - Intronic
1119825787 14:77656008-77656030 CAAGCAGATCACCTGAGGTCAGG - Intergenic
1120317490 14:82914553-82914575 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1120519490 14:85509970-85509992 CAGGCGAATCACCTGAAGTCAGG + Intergenic
1120794737 14:88619890-88619912 CAGGCAGATCACCTGAAGTCAGG - Exonic
1121195344 14:92066995-92067017 CAGGCAGATCACCTGAAGTCAGG - Intronic
1121557937 14:94852326-94852348 CAAGCAGATCACCTGAGGTCAGG + Intergenic
1121626105 14:95386550-95386572 CAGGCAGATCACCTGAGGGCAGG - Intergenic
1121660523 14:95631994-95632016 CAAGCAGATCACCTGAGGTCAGG - Intergenic
1121966953 14:98318117-98318139 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1122111288 14:99504744-99504766 TAAAAAATTCACCTGTAGGCTGG - Exonic
1122235068 14:100326744-100326766 CAGGCAGATCACCTGTGGTCAGG + Intronic
1122361016 14:101163977-101163999 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1122516564 14:102313002-102313024 CGAGCAAATCACCTGAGGTCAGG + Intergenic
1122528469 14:102407085-102407107 CAAGCAGATCACCTGAGGTCAGG - Intronic
1122559988 14:102606287-102606309 CAGGCAAATCACCTGAGGTCAGG - Intronic
1122664838 14:103321702-103321724 CAAGCAAATCACCTGACCTCAGG + Intergenic
1122676804 14:103422226-103422248 CAGGCAGATCACCTGAAGTCAGG + Intronic
1123975181 15:25546746-25546768 CAAGCAGATCACCTGAGGTCAGG - Intergenic
1123981249 15:25606591-25606613 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1124030178 15:26003422-26003444 CAGGCAAATCACCTGAGGTCGGG + Intergenic
1124076442 15:26449817-26449839 CAAACAAATCTCCAGGAGGCAGG - Intergenic
1124318813 15:28695653-28695675 CAGGCAAATCACCTGATGTCAGG + Intergenic
1124924131 15:34054963-34054985 CAGGCAGATCACCTGAAGTCAGG + Intronic
1124933298 15:34144792-34144814 CAAGCAGATCACCTGAGGTCAGG - Intronic
1125069313 15:35532874-35532896 CAGGCAGATCACCTGAAGTCAGG + Intronic
1125284746 15:38080389-38080411 CAGGCAAATCACCTGAGGTCAGG + Intergenic
1125595162 15:40880430-40880452 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1125626193 15:41111216-41111238 CAGGCAAATCACCTGAGGTCAGG + Intronic
1125630174 15:41140877-41140899 CAAGCAGATCACCTGAGGTCAGG - Intergenic
1125635156 15:41181767-41181789 CAGGCGAATCACCTGAAGTCAGG - Intergenic
1125846914 15:42864355-42864377 CAGGCAGATCACCTGAAGTCAGG + Intronic
1126471650 15:49018499-49018521 CAAGCAGATCACCTGAGGTCAGG - Intronic
1126636825 15:50788135-50788157 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1126784845 15:52169307-52169329 CAGGCAGATCACCTGAAGTCAGG + Intronic
1126892651 15:53222863-53222885 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1127065141 15:55229446-55229468 CAGGCAGATCACCTGAAGTCAGG + Intronic
1127257489 15:57304488-57304510 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1127416986 15:58767881-58767903 CAGGCAGATCACCTGCAGTCGGG - Intergenic
1127438150 15:58978869-58978891 CAGGCGAATCACCTGAAGTCAGG + Intronic
1127486939 15:59427336-59427358 CAAGCAAATCACTTGAGGTCAGG - Intronic
1127517954 15:59714443-59714465 CAGGCAAATCACCTGAAGTCAGG - Intergenic
1127609336 15:60621818-60621840 CAAGCAGATCACCTGAGGTCAGG + Intronic
1127876511 15:63116323-63116345 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1127925626 15:63537910-63537932 CAGGCAAATCACCTGAGGTCAGG - Intronic
1128027565 15:64451338-64451360 CAAGCAAATCACTTGAGGTCAGG - Intronic
1128043084 15:64592687-64592709 CAGGCAGATCACCTGTGGTCAGG + Intronic
1128169461 15:65498192-65498214 CAGGCAGATCACCTGAAGTCAGG + Intronic
1128492891 15:68167932-68167954 CAAGCAGATCACCTGAGGTCAGG - Intronic
1128644762 15:69368278-69368300 CAGGCAGATCACCTGTGGTCAGG - Intronic
1129099352 15:73244721-73244743 CAAGCAGATCACCTGAGGTCAGG + Intronic
1129518954 15:76173703-76173725 CAGGCAGATCACCTGAGGGCAGG + Intronic
1129645829 15:77431437-77431459 CAGGCAAATCACCTGAGGTCAGG - Intronic
1129764422 15:78152585-78152607 CAGGCAAATCACCTGAGGTCAGG - Intronic
1130242631 15:82210632-82210654 CAGGCAAATCACCTGAGGTCAGG + Intronic
1130336658 15:82962447-82962469 CAGGCAGATCACCTGAAGTCAGG + Intronic
1130606628 15:85323568-85323590 CAAGGACATTACCTCTAGGCAGG - Intergenic
1131073751 15:89482027-89482049 CAGGCAGATCACCTGAAGTCAGG - Intronic
1131841631 15:96443354-96443376 CAGGCAAATCACCTGAGGGCAGG - Intergenic
1132257039 15:100384740-100384762 CAACAAAATCACCTGTTGTCAGG + Intergenic
1132393678 15:101456942-101456964 CAAGCAGATCACCTGGGGTCGGG + Intronic
1132774169 16:1582674-1582696 CAGGCAAATCACCTGAGGTCAGG + Intronic
1132810876 16:1796357-1796379 CAGGCAAATCACCTGAGGTCAGG - Intronic
1133261703 16:4555033-4555055 CAAGCAGATCACCTGAGGTCGGG + Intergenic
1133266050 16:4584759-4584781 CAGGCAAATCACCTGAGGTCAGG - Intronic
1133582083 16:7154462-7154484 CAAGCAAATGACCTCTTGTCAGG - Intronic
1133703065 16:8326982-8327004 CAAGCGGATCACCTGAAGTCAGG - Intergenic
1134087169 16:11365428-11365450 CAGGCAGATCACCTGAAGTCAGG - Intronic
1134171558 16:11973727-11973749 CAAGCAGATCACCTGAGGTCAGG - Intronic
1134213801 16:12300097-12300119 CAGGCAGATCACCTGAAGTCAGG - Intronic
1134368047 16:13597492-13597514 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1134405412 16:13954088-13954110 CAAGCAGATCACCTGAGGTCAGG - Intergenic
1134585474 16:15406696-15406718 CAGGCAAATCACCTGAGGTCAGG + Intronic
1134597672 16:15509032-15509054 CAAGCTAAGCACCTGGAGCCTGG + Intronic
1134823855 16:17268898-17268920 CAGGCAGATCACCTGAAGTCAGG - Intronic
1135328003 16:21539714-21539736 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1135433002 16:22402804-22402826 CAAAAATATCACATGTAGGCAGG + Intronic
1135686747 16:24503848-24503870 CAGGCAGATCACCTGAGGGCAGG + Intergenic
1135766751 16:25184355-25184377 CAAGCAGATCACCTGAGGTCAGG - Intergenic
1135802266 16:25508438-25508460 TAAGAATATCACCTGTATGCAGG + Intergenic
1136176320 16:28519450-28519472 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1136184622 16:28579701-28579723 CAAGCAGATCACCTGAGGTCAGG + Intronic
1136239267 16:28934169-28934191 CAGGCAGATCACCTGAAGTCAGG - Intronic
1136319503 16:29473933-29473955 CAGGCAAATCACCTGAGGTCAGG + Intergenic
1136338356 16:29625738-29625760 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1136350488 16:29703800-29703822 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1136358693 16:29763586-29763608 CAAGAAAAGCACCAGCAGGCTGG + Intergenic
1136434074 16:30213277-30213299 CAGGCAAATCACCTGAGGTCAGG + Intergenic
1136456892 16:30384947-30384969 CAGGCAGATCACCTGTGGTCAGG + Intronic
1136495734 16:30642719-30642741 CAAGCAGATCACCTGAAGTTGGG - Intergenic
1136532955 16:30882188-30882210 CAGGCAAATCACCTGAGGTCAGG - Intronic
1136583403 16:31168432-31168454 CAAGCAGATCACCTGAGGTCAGG - Intergenic
1136618407 16:31412269-31412291 CAAGCAGATCACCTGAGGTCAGG - Intronic
1136623905 16:31449762-31449784 CAAGCAGATCACCTGAGGTCAGG + Intergenic
1136657263 16:31717221-31717243 CAGGCAGATCACCTGAAGTCAGG - Intronic
1137035980 16:35570343-35570365 AAATCAAATCACCTGTGTGCAGG + Intergenic
1137043484 16:35636373-35636395 CAAGCAGATCACCTGAGGTCAGG - Intergenic
1137642187 16:50042106-50042128 CAAGCGGATCACCTGAAGTCAGG + Intergenic
1137642460 16:50044749-50044771 CAGGCAAATCACCTGAGGTCAGG + Intergenic
1138413779 16:56859541-56859563 CAAGCAGATCACCTGAAGTCAGG - Intergenic
1139095402 16:63698979-63699001 CAGGCGAATCACCTGAAGTCAGG - Intergenic
1139347392 16:66312862-66312884 CAAGCGGATCACCTGAAGCCAGG + Intergenic
1139367114 16:66440356-66440378 CAGGCAGATCACCTGAAGTCAGG - Intronic
1139399040 16:66665515-66665537 CAGGCAGATCACCTGAAGTCAGG + Intronic
1139501893 16:67373477-67373499 CAGGCAGATCACCTGAAGTCAGG + Intronic
1139579908 16:67866692-67866714 CAGGCAAATCACCTGAGGTCAGG - Intronic
1139731561 16:68950336-68950358 CAAGCAGATCACCTGAGGTCAGG + Intronic
1139794630 16:69472269-69472291 CAGGCAAATCACCTGAGGTCAGG + Intergenic
1140392259 16:74597489-74597511 CAAGCAGATCACCTGAGGTCAGG + Intronic
1140510068 16:75500721-75500743 CAAGCAGATCACCTGAGGTCGGG - Intergenic
1140981679 16:80115982-80116004 CAGGCAAATCACCTGAGGTCAGG + Intergenic
1141027720 16:80563753-80563775 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1141668580 16:85479529-85479551 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1141938400 16:87257428-87257450 CAGGCAAATCACCTGAGGTCAGG + Intronic
1141996694 16:87640618-87640640 CGAGCAGATCACCTGAAGTCAGG - Intronic
1142003232 16:87675965-87675987 AAAGCAGATCAGCTGTTGGCAGG + Intronic
1142013758 16:87732321-87732343 CAGGCAAATCACCTGAGGTCAGG - Intronic
1142019920 16:87775722-87775744 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1142041087 16:87894649-87894671 CAGGCAGATCACCTGAAGTCAGG + Intronic
1142381689 16:89736252-89736274 CAGGCAAATCACCTGAGGTCAGG - Intronic
1142448013 16:90155241-90155263 CAGGCAAATCACCTGAAGTCTGG - Intergenic
1142459475 17:80083-80105 CAGGCAAATCACCTGAAGTCTGG + Intergenic
1142807347 17:2378346-2378368 CAAGCAAATCACTTGAGGTCAGG + Intronic
1142862850 17:2773983-2774005 CAGGCAGATCACCTGAGGGCAGG - Intergenic
1143087149 17:4424661-4424683 CAAGCGGATCACCTGAAGTCAGG - Intergenic
1143087667 17:4428307-4428329 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1143113226 17:4565275-4565297 CAAGCAGATCACCTGAGGTCAGG - Intergenic
1143225135 17:5295152-5295174 CGGGCAAATCACCTGAAGTCAGG + Intronic
1143262168 17:5607546-5607568 CAGGCAGATCACCTGAAGTCAGG - Intronic
1143298161 17:5886824-5886846 CAAGCAGATCACCTGAGGTCGGG - Intronic
1143603765 17:7968494-7968516 CAAGCAGATCACCTGAGGTCGGG - Intergenic
1143668472 17:8379345-8379367 CAGGCAAATCACCTGAGGTCAGG + Intronic
1143678484 17:8456724-8456746 CAGGCAGATCACCTGAAGTCAGG - Intronic
1143708992 17:8720753-8720775 CAGGCCAATCACCTGAAGTCAGG - Intergenic
1144584252 17:16478411-16478433 CAGGCAGATCACCTGTAGTCAGG - Intronic
1144695242 17:17299731-17299753 CAGGCAGATCACCTGAAGTCGGG + Intergenic
1144698191 17:17320067-17320089 CAAGCAGATCACCTGAGGTCAGG - Intronic
1145069507 17:19791455-19791477 CAGGCAAATCACATGTGGCCAGG + Intronic
1145350746 17:22080903-22080925 CAGGCAGATCACCTGAAGTCGGG + Intergenic
1145405945 17:22594074-22594096 CATGAAAATCACCCTTAGGCAGG - Intergenic
1145715843 17:27020277-27020299 CAAGCAAATCACCTGAGGTCAGG + Intergenic
1146217725 17:30991639-30991661 CAAGCAGATCACCTGAGGTCAGG - Intronic
1146246674 17:31290776-31290798 CAAGCAGATCACCTGAGGTCAGG + Intronic
1146327277 17:31897674-31897696 CAGGCAGATCACCTGTGGTCAGG - Intronic
1146334503 17:31957636-31957658 CGAGCAGATCACCTGAAGTCAGG - Intronic
1146337519 17:31987701-31987723 CAGGCAAATCACCTGAGGTCAGG + Intronic
1146381958 17:32337162-32337184 AAAAGAAACCACCTGTAGGCTGG + Intronic
1146698839 17:34935626-34935648 CAAGCAGATCACCTGAGGTCAGG + Intronic
1146830783 17:36067457-36067479 CAAGCAGATCACCTGAGGTCAGG + Intronic
1147012045 17:37457721-37457743 CAGGCAAATCACCTGAGGTCAGG - Intronic
1147025719 17:37581503-37581525 CAGGCAGATCACCTGAAGTCAGG - Intronic
1147206954 17:38844233-38844255 CAGGCAAATCACCTGAGGTCAGG - Intergenic
1147248340 17:39137325-39137347 CTAGCAAATCACTTGAAGTCAGG + Intronic
1147277377 17:39330063-39330085 CAAGCAGATCACCTGAGGTCAGG + Intronic
1147292742 17:39457028-39457050 CAAGCAGATCACCTGAGGTCAGG - Intergenic
1147300393 17:39521787-39521809 CAGGCAGATCACCTGAAGTCAGG - Intronic
1147478157 17:40733863-40733885 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1147594765 17:41709761-41709783 CAAGCAGATCACCTGAGGTCAGG - Intergenic
1147713978 17:42491708-42491730 CAGGCAGATCACCTGAAGTCAGG - Intronic
1147845863 17:43403530-43403552 CAGGCAAATCACTTGAAGTCAGG - Intergenic
1148099012 17:45075840-45075862 CAGGCAGATCACCTGAAGTCAGG + Intronic
1148452401 17:47788152-47788174 CAGGCAGATCACCTGAAGCCCGG + Intergenic
1148529134 17:48372530-48372552 CAGGCAAATCACCTGAGGTCAGG - Intronic
1148645155 17:49215874-49215896 CAGGCAAATCACCTGAGGTCGGG + Intronic
1148653840 17:49268687-49268709 CAAGCAGATCACCTGAGGTCGGG + Intergenic
1148708894 17:49661784-49661806 CAGGCAAATCACCTGAAGTCGGG + Intronic
1148937455 17:51174989-51175011 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1149021771 17:51975449-51975471 CAGGCAAATCACCTGAGGCCAGG + Intronic
1149321804 17:55489148-55489170 CAGGCAAATCACCTGAGGTCAGG + Intergenic
1149458171 17:56806268-56806290 AAAGAAAATCAACTGTAGGCCGG - Intronic
1149629716 17:58112467-58112489 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1149733717 17:58972576-58972598 CAGGCAGATCACCTGAAGTCAGG - Intronic
1149878608 17:60264765-60264787 CAAGAAAATCACTTGAAGCCGGG + Intronic
1149894659 17:60420438-60420460 CAAGCAGATCACCTGAAGTCGGG + Intronic
1149909514 17:60554128-60554150 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1149932650 17:60771033-60771055 CAGGCAGATCACCTGAAGTCAGG - Intronic
1149935467 17:60802078-60802100 CAAGCAGATCACCTGAGGTCAGG + Intronic
1150066880 17:62117648-62117670 CAGGCAAATCACCTGAGGTCAGG + Intergenic
1150252224 17:63712771-63712793 CAGGCAGATCACCTGAAGTCAGG + Intronic
1150541022 17:66099274-66099296 CAGGCAGATCACCTGCAGTCAGG + Intronic
1151264874 17:72947091-72947113 CAGGCAGATCACCTGAAGTCAGG + Intronic
1151565778 17:74897114-74897136 CAAGCAGATCACCTGAGGTCAGG + Intergenic
1151571780 17:74929953-74929975 CAAGCAGATCACCTGAGGTCAGG + Intronic
1151646768 17:75437838-75437860 CAGGCAAATCACCTGAGGTCAGG + Intergenic
1151760491 17:76099276-76099298 CAAGCAGATCACCTGAGGTCAGG + Intronic
1151895660 17:76978964-76978986 CACCCATATCACCTGTAGGAAGG + Intergenic
1151910253 17:77078153-77078175 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1151924408 17:77184011-77184033 CAAGCGAATCACCTGAGGTCAGG - Intronic
1152055426 17:78021795-78021817 CAGGCAGATCACCTGAAGTCAGG - Intronic
1152171098 17:78749230-78749252 CAGGCAGATCACCTGTGGTCAGG + Intronic
1152653547 17:81508522-81508544 CAAGCAAATCACCTGCGGTTGGG + Intergenic
1152662373 17:81548509-81548531 CAGGCAAATCACCTGAATCCAGG + Intronic
1152691143 17:81718254-81718276 CAAGCAGATCACCTGAGGTCAGG + Intronic
1152971532 18:166558-166580 CAGGCAAATCACCTGCGGTCAGG - Intronic
1153112094 18:1603709-1603731 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1153233529 18:2964052-2964074 CAAGCAGATCACTTGAAGTCAGG + Intronic
1153311170 18:3678295-3678317 CAAACAAATGACCTGGAGGTGGG - Intronic
1153332000 18:3883014-3883036 CAGGCGAATCACCTGAAGTCAGG + Intronic
1153701568 18:7699635-7699657 CAGGCAGATCACCTGCAGTCAGG - Intronic
1154113753 18:11592999-11593021 CAAGAAACACACCAGTAGGCTGG + Intergenic
1154162759 18:11992069-11992091 CAGGCAGATCACCTGAAGTCAGG - Intronic
1154248338 18:12719942-12719964 CAGGCAAATCACCTGAGGTCAGG - Intronic
1154337745 18:13479391-13479413 CAGGCGAATCACCTGTTGTCAGG + Intronic
1154357952 18:13636725-13636747 CAGGCAAATCACCTGAGGTCAGG - Intronic
1154469861 18:14689745-14689767 CAAGCAGATCACCTGAGGTCAGG - Intergenic
1154472107 18:14713812-14713834 CAAGCAAATCACCTGAGGTCAGG - Intergenic
1155057724 18:22199673-22199695 CAAGCAGATCACCTGAGGTCAGG + Intronic
1155147693 18:23097638-23097660 CAGGCAAATCACCTGAGGTCAGG + Intergenic
1155248890 18:23937136-23937158 CAGGCAAATCACCTGAGGTCAGG + Intronic
1155401338 18:25442618-25442640 CAAGCAAATCACTTGAGGCCAGG - Intergenic
1155469543 18:26176703-26176725 CAGGCAGATCACCTGAAGTCGGG + Intronic
1155582585 18:27326233-27326255 CAAGCAACTCACCAGAAGTCAGG + Intergenic
1156293136 18:35766612-35766634 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1156384290 18:36591989-36592011 CAGGCAGATCACCTGAAGTCAGG + Intronic
1156527076 18:37777676-37777698 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1156567872 18:38216850-38216872 CAAGCAGATCACCTGAGGTCGGG + Intergenic
1156573133 18:38281406-38281428 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1156895526 18:42241147-42241169 CAAGCAGATCACCTGAGGTCAGG + Intergenic
1157601294 18:48894573-48894595 CAGGCAAATCACCTGAGGTCAGG + Intergenic
1157643434 18:49242182-49242204 CAGGCAGATCACCTGAAGTCAGG + Intronic
1158338088 18:56435087-56435109 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1158449533 18:57551610-57551632 CAAACAAACCACCTTTAGGAAGG - Intronic
1158474519 18:57768156-57768178 CAGGCAGATCACCTGCAGTCAGG + Intronic
1158518860 18:58153567-58153589 AAAGCAGATCACCTGAAGTCAGG - Intronic
1158693713 18:59684219-59684241 CAAGCAGATCACCTGAGGCCAGG + Intronic
1158705094 18:59785328-59785350 CAGGCAGATCACCTGAGGGCGGG + Intergenic
1158892373 18:61884784-61884806 CAGGCAGATCACCTGAAGTCAGG - Intronic
1159109134 18:64036329-64036351 CAAGCAGATCACCTGAGGTCAGG + Intergenic
1159686692 18:71430507-71430529 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1159875566 18:73806963-73806985 CAAGCAGATCACCTGAGGTCAGG - Intergenic
1160358812 18:78252201-78252223 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1160561454 18:79760071-79760093 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1160649191 19:212590-212612 CAGGCAAATCACCTGAAGTCTGG + Intergenic
1160809189 19:1005770-1005792 CAGGCAGATCACCTGAAGTCAGG + Intronic
1160891804 19:1382869-1382891 CAGGCAAATCACCTGAGGTCAGG - Intergenic
1160977251 19:1799228-1799250 CAGGCAGATCACCTGAAGTCAGG + Intronic
1161019139 19:1999731-1999753 CAGGCAAATCACCTGGGGTCAGG + Intronic
1161385090 19:3987301-3987323 CAGGCAAATCACCTGAAGTCAGG + Intergenic
1161440077 19:4286117-4286139 CAAGCACATCACCTGAGGTCAGG - Intronic
1161887585 19:7008937-7008959 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1161912796 19:7207186-7207208 CAAGCAGATCACCTGAGGTCGGG + Intronic
1162017841 19:7855317-7855339 CAGGCAAATCACCTGAGGTCAGG - Intronic
1162091642 19:8284116-8284138 CAGGCAAATCACCTGAGGTCGGG + Intronic
1162093879 19:8298964-8298986 CAGGCAAATCACCTGAGGTCGGG + Intronic
1162161160 19:8718287-8718309 CAGGCAAATCACCTGAGGTCAGG - Intergenic
1162198647 19:9005424-9005446 CAAGCAGATCACCTGAAGTCAGG + Intergenic
1162257789 19:9506218-9506240 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1162272052 19:9624186-9624208 CAGGCAAATTACCTGAAGTCGGG + Intronic
1162276562 19:9660397-9660419 CAGGCAAATCACCTGAGGTCGGG + Intronic
1162280758 19:9695753-9695775 CAAGCAAATCACTTGTGGTCGGG + Intronic
1162285402 19:9735171-9735193 CAGGCAAATCACCTGAGGTCAGG - Intergenic
1162303911 19:9859912-9859934 CAGGCAAATCACCTGCAGTCAGG + Intronic
1162376344 19:10307741-10307763 CGAGCAGATCACCTGAAGTCAGG - Intronic
1162420468 19:10563281-10563303 CAGGCAAATCACCTGAGGTCAGG - Intronic
1162444058 19:10711687-10711709 CAAGCAGATCACTTGAAGTCTGG - Intronic
1162516637 19:11152146-11152168 CAAGCAGATCACCTGAGGTCAGG - Intronic
1162690354 19:12424893-12424915 CAGGCAGATCACCTGAAGTCAGG + Intronic
1162870396 19:13581926-13581948 CAGGCAGATCACCTGAAGTCAGG + Intronic
1162900205 19:13790742-13790764 CAGGCAAATCACCTGAGGTCGGG + Intergenic
1163058576 19:14741322-14741344 CAAGCAAATCACCTGAGGCCAGG - Intronic
1163170732 19:15529354-15529376 CAAGCAGATCACCTGAGGTCAGG - Intronic
1163486328 19:17588797-17588819 CAGGAAAATCACCTGAAGTCAGG - Intergenic
1163543296 19:17924933-17924955 CAGGCAAATCACCTGAGGTCAGG - Intergenic
1163563294 19:18033915-18033937 CAAGCAGATCACCTGAGGTCAGG + Intergenic
1163759632 19:19128763-19128785 CAAGCAGATCACCTGAGGTCGGG - Intronic
1163841275 19:19612039-19612061 CAGGCAGATCACCTGAAGCCAGG + Intronic
1163844924 19:19633283-19633305 CAGGCAAATCACCTGAGGTCAGG - Intronic
1163852549 19:19673176-19673198 CAGGCAAATCACCTGAGGTCAGG - Intronic
1163891951 19:20024608-20024630 CAGGCAGATCACCTGAAGTCAGG + Intronic
1164089580 19:21936235-21936257 TAATCAAATCACCTGAATGCTGG - Intronic
1164161866 19:22632161-22632183 CAGGCAGATCACCTGAAGTCGGG - Intergenic
1164163565 19:22647959-22647981 CAGGCAAATCACCTGAAATCAGG - Intronic
1164240944 19:23388642-23388664 CAGGCAAATCACCTGAGGTCAGG + Intronic
1164269740 19:23661461-23661483 TAAGCAAATGACCTGAGGGCAGG + Intronic
1164276225 19:23721031-23721053 CAGGCAAATCACCTGAGGTCAGG + Intergenic
1164547981 19:29184882-29184904 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1164943177 19:32267620-32267642 CAGGCGAATCACTTGTAGCCAGG - Intergenic
1165373781 19:35427015-35427037 CAGGCAGATCACCTGTGGTCAGG + Intergenic
1165498181 19:36166641-36166663 CAGGCAAATCATCTGTGGTCAGG - Intergenic
1165640195 19:37378253-37378275 CAGGCAGATCACCTGAAGTCAGG - Intronic
1165853047 19:38862213-38862235 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1165962570 19:39547676-39547698 CAGGCGAATCACCTGAAGTCAGG - Intergenic
1166032332 19:40141584-40141606 CAAGCAGATCACCTGAGGTCAGG + Intergenic
1166038589 19:40188463-40188485 CAGGCAAATCACCTGAGGTCAGG - Intergenic
1166089539 19:40499265-40499287 CAAGCAGATCACTTGAAGTCAGG - Intronic
1166337865 19:42119578-42119600 CAAGAGAATCACCTGAAGCCGGG + Intronic
1166370737 19:42299342-42299364 CAAGCAGATCACCTGAGGTCGGG - Intronic
1166707768 19:44917749-44917771 CAAGCAGATCACCTGAGGTCAGG + Intronic
1166727077 19:45035067-45035089 CAAGCAGATCACCTGAGGTCAGG - Intronic
1166728375 19:45042842-45042864 CAAGCAAATCACTTGAGGTCGGG - Intronic
1166754679 19:45183250-45183272 CAGGCAGATCACCTGAAGTCAGG + Intronic
1166835211 19:45663475-45663497 CAGGCCAATCACCTGAAGTCAGG + Intergenic
1166835518 19:45665451-45665473 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1166881012 19:45930054-45930076 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1167095221 19:47371825-47371847 CAAGCAGATCACCTGAGGTCAGG - Intronic
1167103032 19:47415798-47415820 CAAGCAGATCACCTGAGGTCAGG - Intronic
1167124845 19:47542426-47542448 CAAGCACATCACCTGAGGTCAGG + Intronic
1167281281 19:48570404-48570426 CAGGCAAATCACCTGAGGTCAGG - Intronic
1167355628 19:49002275-49002297 CAAGCAGATCACCTGAGGTCAGG - Intronic
1167678178 19:50902064-50902086 CAAGCAGATCACCTGAGGTCAGG + Intergenic
1167857823 19:52256856-52256878 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1167895979 19:52581445-52581467 CAGGCAAATCACCTGAGGTCAGG - Intronic
1167954249 19:53051371-53051393 CGAGCGAATCACCTGAAGTCAGG - Intergenic
1167956197 19:53066141-53066163 CAAGCAGATCACCTGAAGTCAGG - Intergenic
1167989352 19:53344864-53344886 CAGGCAGATCACCTGAAGTCGGG - Intronic
1167989536 19:53346451-53346473 CAGGCAAATCACCTGAGGTCAGG + Intronic
1167996109 19:53403614-53403636 CAGGCAAATCACCTGAGGTCAGG + Intronic
1168001596 19:53450767-53450789 CAGGCAAATCACCTGAGGTCAGG + Intronic
1168005971 19:53487568-53487590 CAGGCAAATCACCTGAGGTCAGG + Intronic
1168017320 19:53583916-53583938 CAGGCAGATCACCTGAAGTCTGG + Intergenic
1168031604 19:53684144-53684166 CAGGCTAATCACCTGGAGTCAGG + Intergenic
1168135497 19:54348503-54348525 CGAGCAGATCACCTGAAGTCAGG - Intergenic
1168217592 19:54937668-54937690 CAGGCAAATCACCTGAGGTCAGG + Intronic
1168321022 19:55509627-55509649 CAGGCAGATCACCTGAAGCCAGG + Intronic
1168395316 19:56042574-56042596 CAGGCAGATCACCTGTGGTCAGG - Intronic
1168661737 19:58172705-58172727 CAGGCAGATCACCTGAAGCCAGG - Intergenic
924972896 2:146179-146201 CAGGCAAATCACCTGAGGTCAGG - Intergenic
925172232 2:1757192-1757214 CAGGCAAATCACCTGAGGTCAGG + Intergenic
925192610 2:1897688-1897710 CAGGCAGATCACCTGAAGTCAGG - Intronic
925571078 2:5313531-5313553 CAAGGAAATCAGCTGTCAGCAGG - Intergenic
925966767 2:9073812-9073834 CAAGCAGATCACCTGAGGTCAGG - Intergenic
926166962 2:10527193-10527215 CAGGCAGATCACCTGAAGTCAGG - Intergenic
926190770 2:10725850-10725872 CAGGCAGATCACCTGAAGTCGGG + Intronic
926204554 2:10826585-10826607 CAAGCAGATCACCTGAGGTCAGG - Intronic
926211769 2:10876281-10876303 CAGGCAGATCACCTGAAGTCAGG - Intergenic
926291785 2:11537189-11537211 CAGGCAAATCACCTGTGGTCAGG - Intronic
926713943 2:15908969-15908991 CAGGCGAATCACCTGAAGTCAGG + Intergenic
926716026 2:15924323-15924345 CAAGCAGATCACCTGAGGTCAGG + Intergenic
926893851 2:17662294-17662316 CAAGCAGATCACCTGAGGTCAGG + Intergenic
926916864 2:17900715-17900737 CAGGCAGATCACCTGAAGTCAGG - Intronic
927047622 2:19295832-19295854 CAAGCAGATCACCTGAGGTCAGG + Intergenic
927588492 2:24332014-24332036 CAGGCAGATCACCTGAAGTCAGG + Intronic
927735452 2:25516660-25516682 CAAGCAGATCACCTGAGGTCAGG + Intronic
928021282 2:27706969-27706991 CAAGCAGATCACCTGAGGTCAGG - Exonic
928164135 2:28957294-28957316 CAAGCAATTCTCCTGTAGCCGGG + Intronic
928570841 2:32606776-32606798 CAGGCAGATCACCTGAAGTCAGG + Intronic
928643286 2:33323407-33323429 CAGGCAGATCACCTGAAGTCAGG + Intronic
929162453 2:38846091-38846113 CGAGCAGATCACCTGAGGGCGGG - Intronic
929169178 2:38914438-38914460 CAAGCGGATCACCTGAAGTCAGG + Intronic
929415331 2:41741423-41741445 CAGGCAAATCACCTGAGGTCAGG + Intergenic
929517416 2:42616288-42616310 CAGGCAGATCACCTGAAGTCAGG - Intronic
929667934 2:43847990-43848012 CAAGCAGATCACCTGAGGCCAGG - Intronic
929704084 2:44192441-44192463 CAGGCAAATCACCTGAGGTCAGG - Intronic
929735314 2:44541899-44541921 CAGGCAGATCACCTGCAGTCAGG + Intronic
930126838 2:47805403-47805425 CAAGCAGATCACCTGAGGTCAGG - Intronic
931276669 2:60750015-60750037 CAAGCAGATCACCTGAGGTCAGG + Intergenic
931346006 2:61447025-61447047 CAAGCAGATCACCTGAGGTCAGG + Intronic
931347284 2:61458331-61458353 CAGGCAAATCACCTGAGGTCAGG + Intronic
931364996 2:61611703-61611725 CAAGCAGATCACCTGAGGTCAGG - Intergenic
931588233 2:63852358-63852380 CATACAAATCACTTGGAGGCTGG - Intronic
931669024 2:64630337-64630359 CCAGCAAACCACCAGAAGGCAGG - Intergenic
931704822 2:64938528-64938550 CAAGCACATCACCTGAGGTCAGG - Intergenic
931713073 2:65006262-65006284 CAGGCAGATCACCTGAAGTCAGG + Intronic
932220436 2:69995053-69995075 CAAGCACATCACATGTAGTCAGG + Intergenic
932289238 2:70561352-70561374 CAGGCAGATCACCTGTGGTCAGG - Intergenic
932671125 2:73738643-73738665 CAGGCAGATCACCTGAAGTCGGG + Intergenic
933156254 2:78979084-78979106 CAGGCAGATCACCTGCAGTCAGG - Intergenic
933719254 2:85386766-85386788 CAAGCAGATCACCTGAGGTCGGG + Intronic
933724237 2:85417709-85417731 CAAGCAGATCACCTGAGGTCAGG - Intronic
933733974 2:85480277-85480299 CAAGCAGATCACCTGAGGTCAGG + Intergenic
933968354 2:87449153-87449175 CAAGCAGATCACCTGAGGTCAGG - Intergenic
934550991 2:95261520-95261542 CAGGCAAATCACCTGAGGTCAGG - Intergenic
934611760 2:95743553-95743575 CAGGCAAATCACCTGAGGTCAGG + Intergenic
935006844 2:99087277-99087299 CAGGCAGATCACCTGCAGTCAGG + Intronic
935043488 2:99457452-99457474 CAGGCAAATCACCTGAGGTCAGG + Intronic
935635413 2:105246173-105246195 CAGGCAAATCACCTGAGGTCAGG - Intergenic
936077874 2:109413339-109413361 CAAGCAGATCACCTGAGGTCAGG - Intronic
936325441 2:111501351-111501373 CAAGCAGATCACCTGAGGTCAGG + Intergenic
936399929 2:112157140-112157162 CAGGCAGATCACCTGAAGTCAGG + Intronic
936545093 2:113385169-113385191 CAGGCAAATCACCTGATGTCAGG + Intergenic
936875629 2:117185841-117185863 CAGGCAGATCACCTGAAGTCAGG + Intergenic
937309871 2:120895473-120895495 CAGGCAAATCACCTGAGGTCAGG + Intronic
937438333 2:121897186-121897208 CAAGCACATTACCAGGAGGCAGG - Intergenic
937847406 2:126596280-126596302 CAGGCAGATCACCTGAAGTCAGG + Intergenic
938174363 2:129110808-129110830 CAAGCAGATCACCTGAAGTCAGG + Intergenic
938858805 2:135344506-135344528 CAGGCAAATCACCTGAGGTCAGG + Intronic
938896624 2:135758299-135758321 CAAGCAGATCACCTGAGGTCAGG - Intronic
938972528 2:136445586-136445608 CAGGCAGATCACCTGAAGTCAGG + Intergenic
939707341 2:145471262-145471284 CAGGCAGATCACCTGAAGTCAGG + Intergenic
939712648 2:145541994-145542016 CAAGCAGATCACCTGAGGTCAGG - Intergenic
939880644 2:147627145-147627167 CAGGCAGATCACCTGAAGTCAGG + Intergenic
940207855 2:151223891-151223913 CAGGCAAATCACCTGAGGTCAGG - Intergenic
940294705 2:152110445-152110467 CAGGCAGATCACCTGAGGGCAGG - Intergenic
940295136 2:152114787-152114809 CAGGCAGATCACCTGAAGTCAGG + Intergenic
940523576 2:154782947-154782969 CAGGCAGATCACCTGAGGGCAGG + Intronic
940598086 2:155819930-155819952 CAAGCAGATCACCTGAGGTCAGG - Intergenic
940721713 2:157289842-157289864 CAGGCAGATCACCTGAAGTCAGG + Intronic
940936446 2:159500724-159500746 CATGCAGATCACCTGAAGTCAGG + Intronic
940952962 2:159697011-159697033 CAAGTGAATCACCTGAAGTCAGG - Intergenic
940973355 2:159917986-159918008 CAAGCAGATCACCTGAGGTCAGG + Intergenic
941163590 2:162062039-162062061 CAGGCAAATCACCTGAGGTCAGG + Intronic
941363327 2:164580318-164580340 CAGGCAAATCACCTGAGGTCAGG - Intronic
941581353 2:167300130-167300152 CAGGCAAATCACCTGAGGTCAGG - Intergenic
941642183 2:168000129-168000151 CATGCAATTCACCTGTTTGCAGG - Intronic
941881221 2:170482380-170482402 CAGGCAGATCACCTGAAGTCAGG - Intronic
941914552 2:170802041-170802063 CGAGCAAATCACCTGAAGTCAGG - Intergenic
941915524 2:170810896-170810918 CAGGCAAATCACCTGAGGTCAGG - Intergenic
941943948 2:171074116-171074138 CAAGCAGATCACCTGAGGTCAGG - Intronic
941968548 2:171324832-171324854 CAGGCAAATCACCTGAGGTCAGG + Intronic
942026734 2:171918155-171918177 CAGGCAAATCACATGAAGTCAGG - Intronic
942069755 2:172305608-172305630 CAGGCAAATCACCTGAGGTCAGG - Intergenic
942083494 2:172423828-172423850 CAGGCAGATCACCTGAAGTCAGG - Intergenic
942243923 2:173990096-173990118 CAAGCTACTCACCTTTAGGTCGG + Intergenic
943365913 2:186967407-186967429 CAGGCAAATCACCTGAGGTCGGG + Intergenic
943463114 2:188194293-188194315 CAAGCAGATCACCTGAGGTCAGG + Intergenic
943593847 2:189831739-189831761 AAAGCTAATCAGCTCTAGGCTGG + Intronic
943678816 2:190746051-190746073 CAGGCAGATCACCTGAAGTCAGG + Intergenic
944360003 2:198842620-198842642 CAAGAAAATGTCATGTAGGCTGG - Intergenic
944493329 2:200281279-200281301 CAACCATATCACCTGTAAACAGG - Intergenic
944588259 2:201192165-201192187 CAAGCAGATCACCTGAGGTCAGG + Intronic
944836963 2:203589369-203589391 CAAGCAGATCACCTGAGGTCAGG - Intergenic
944954362 2:204790875-204790897 CAGGCAGATCACCTGAAGTCAGG + Intronic
945086228 2:206135251-206135273 CAGGCAAATCACCTGAGGTCAGG - Intronic
945224559 2:207520190-207520212 CAGGCAGATCACCTGAAGTCAGG + Intergenic
946308510 2:218869990-218870012 CAGGCAGATCACCTGAAGTCAGG + Intronic
946344882 2:219101340-219101362 CAAGCAGATCACCTGAGGTCAGG - Intronic
946494707 2:220184139-220184161 CAAGCTAGTCACCTGTGGTCAGG - Intergenic
947168818 2:227290268-227290290 CAAGCAGATCACCTGAGGTCAGG + Intronic
947303416 2:228715652-228715674 CAAGCAGATCACCTGAGGTCAGG - Intergenic
947438924 2:230100161-230100183 CAGGCAGATCACCTGAAGTCAGG - Intergenic
947619458 2:231580226-231580248 CAGGCAGATCACCTGAAGTCAGG + Intergenic
947788984 2:232851645-232851667 CAAGAAGATCACCTGAAGTCAGG - Intronic
947855742 2:233323284-233323306 CAGGCAGATCACCTGTGGTCAGG - Intronic
947857327 2:233333021-233333043 CAAGCAGATCACCTGAGGTCAGG - Intronic
947930610 2:233961855-233961877 CAGGCAAATCACCTGAGGTCAGG - Intronic
948137548 2:235648058-235648080 CAAGCCAGGCAGCTGTAGGCTGG + Intronic
948190834 2:236057334-236057356 CAGGCAAATCACCTGAGGTCAGG - Intronic
948983420 2:241506538-241506560 CAAGCAGATCACCTGAGGTCAGG + Intronic
1169013569 20:2272620-2272642 CAAGCAGATCACCTGAGGTCAGG + Intergenic
1169099566 20:2934897-2934919 CAAGCAGATCACCTGAGGTCAGG - Intronic
1169105534 20:2991124-2991146 CAGGCAGATCACCTGAAGCCAGG + Intronic
1169153574 20:3309963-3309985 CAGGCAGATCACCTGAAGTCGGG + Intronic
1169230131 20:3882653-3882675 CAGGCAGATCACCTGTGGTCGGG + Intergenic
1169384255 20:5134746-5134768 CAGGCAGATCACCTGAAGTCAGG - Intronic
1169441515 20:5637697-5637719 CAAGCAGATCACTTGAAGTCAGG - Intergenic
1169615398 20:7437888-7437910 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1169647039 20:7823333-7823355 CAAGCAAATCACCTGAGGTCAGG - Intergenic
1169995767 20:11554538-11554560 CAAGCAAAACACATGAAAGCTGG - Intergenic
1170194340 20:13674925-13674947 CAGGCAAATCACCTGAGGTCAGG + Intergenic
1170583864 20:17719357-17719379 CAGGCAGATCACCTGAAGTCAGG - Intronic
1170598261 20:17821602-17821624 CAAGCAAATCACTTGAGGCCAGG + Intergenic
1172027091 20:31955931-31955953 CAAGCAAATTACCTGAGGTCAGG - Intergenic
1172727350 20:37055819-37055841 CAAGCAGATCACCTGAGGTCCGG + Intronic
1172806358 20:37614802-37614824 CAAGCAGATCACTTGAAGTCAGG - Intergenic
1172938934 20:38641394-38641416 CCAGCAAATCACCCTTAGGAAGG - Intronic
1172958613 20:38780846-38780868 CAGGCAAATCACCTGAGGTCAGG + Intergenic
1173270213 20:41527207-41527229 CAAGCAAATCACTTGAGGACAGG + Intronic
1173281675 20:41633820-41633842 CAAGCAGATCACTTGAAGTCAGG - Intergenic
1173446746 20:43126122-43126144 CAGGCAGATCACCTGAAGTCAGG + Intronic
1173466819 20:43289857-43289879 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1173541416 20:43854510-43854532 CAAGCAGATCACCTGAGGTCAGG - Intergenic
1173682390 20:44893922-44893944 CAGGCAGATCACCTGAAGTCAGG - Intronic
1173762683 20:45577777-45577799 CAGGCAGATCACCTGTGGTCAGG + Intronic
1173837223 20:46133918-46133940 CAGGCAGATCACCTGTGGTCAGG + Intergenic
1174197664 20:48785139-48785161 CAGGCGAATCACCTGAAGTCAGG - Intronic
1174229307 20:49031454-49031476 CAAGCAGATCACTTGAAGCCAGG - Intronic
1174415278 20:50362070-50362092 CAGGCAAATCACCTGAGGTCGGG - Intergenic
1174501163 20:50985738-50985760 CAGGCAGATCACCTGTGGTCAGG - Intergenic
1174548182 20:51342132-51342154 CAAGCAGATCACCTGAGGTCGGG + Intergenic
1174598510 20:51704551-51704573 CAGGCAGATCACCTGTGGTCAGG + Intronic
1174635218 20:51993648-51993670 CAGGCAGATCACCTGTGGTCAGG + Intergenic
1174767399 20:53267003-53267025 CAGGCAAATCACCTGAGGTCAGG - Intronic
1175038290 20:56021045-56021067 CAAGAAAACCACCTCGAGGCCGG - Intergenic
1175045067 20:56097126-56097148 CAGGCAGATCACCTGAAGCCAGG + Intergenic
1175117985 20:56696832-56696854 CAAGCAGATCACCTGAGGTCAGG - Intergenic
1175149244 20:56920170-56920192 CAAGCAGATCACCTGAGGTCAGG - Intergenic
1175355616 20:58364960-58364982 CAAGCAGATCACCTGAGGTCAGG - Exonic
1176134580 20:63516448-63516470 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1176142655 20:63552032-63552054 CAAGCAGATCACCTGAGGTCAGG - Intronic
1176514421 21:7773527-7773549 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1176802385 21:13444096-13444118 CAAGCAAATCACCTGAGGTCAGG + Intergenic
1176804639 21:13468114-13468136 CAAGCAGATCACCTGAGGTCAGG + Intergenic
1177144665 21:17394478-17394500 CAAGCAGATCACCTGAGGTCAGG - Intergenic
1177156782 21:17508747-17508769 CAGGCAAATCACCTGAGGTCAGG + Intergenic
1178086548 21:29118310-29118332 CAGGCAAATCACCTGAGGTCAGG - Intronic
1178616353 21:34136373-34136395 CAGGCAGATCACCTGAAGTCAGG - Intronic
1178648534 21:34404051-34404073 CAGGCAGATCACCTGAAGTCAGG - Intronic
1178668644 21:34571064-34571086 CAGGCAGATCACCTGAAGTCGGG + Intronic
1178751383 21:35307184-35307206 CAGGCAGATCACCTGAAGTCAGG + Intronic
1179064495 21:38011814-38011836 CAAGCAGATCACCTGAGGTCAGG - Intronic
1179205700 21:39275803-39275825 CAGGCAGATCACCTGAAGTCGGG + Intronic
1179209025 21:39310409-39310431 CAGGCAGATCACCTGAAGTCAGG + Intronic
1179321549 21:40296602-40296624 CAAGCAGATCACCTGAGGCCTGG + Intronic
1179423095 21:41251571-41251593 CAGGCAAATCACCTGAGGTCAGG + Intronic
1180783126 22:18532568-18532590 CGAGCAGATCACCTGAAGCCAGG + Intergenic
1180889109 22:19272697-19272719 CAGGCAGATCACCTGGAGGTCGG - Intronic
1181126688 22:20706614-20706636 CGAGCAGATCACCTGAAGCCAGG + Intergenic
1181240024 22:21471925-21471947 CGAGCAGATCACCTGAAGCCAGG + Intergenic
1181337160 22:22145707-22145729 CAGGCAAATCACCTGGGGTCAGG - Intergenic
1181695582 22:24591304-24591326 CAGGCAGATCACCTGAAGTCGGG - Intronic
1181962761 22:26634822-26634844 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1182200920 22:28568917-28568939 CAAGCAGATCACCTGAGGTCAGG + Intronic
1182439135 22:30351854-30351876 CAAACAAAACATCTGTAGGCTGG + Intronic
1182534082 22:30987078-30987100 CAGGCAAATCACCTGAGGTCAGG - Intergenic
1182599896 22:31453598-31453620 CAGGCAGATCACCTGAAGTCAGG - Intronic
1183183035 22:36274198-36274220 CAGGCAGATCACCTGAAGTCGGG + Intergenic
1183468302 22:37991344-37991366 CAGGCAAATCACCTGAGGTCAGG - Intronic
1183571262 22:38655300-38655322 CAAGCAGATCACCTGAGGTCAGG + Intronic
1183658183 22:39202915-39202937 CGGGCAGATCACCTGTAGTCAGG + Intergenic
1183858244 22:40650998-40651020 CAAGCAATGCAACTGAAGGCAGG - Intergenic
1184219928 22:43093468-43093490 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1184426905 22:44414637-44414659 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1184485899 22:44779326-44779348 CAGGCAAATCACCTGAGGTCAGG - Intronic
1184866928 22:47206566-47206588 CAGGCAAATCACCTTAAGGTCGG + Intergenic
1185353403 22:50350456-50350478 CAGGCAGATCACCTGAAGTCAGG - Intronic
949379159 3:3425576-3425598 CAGGCAGATCACCTGAAGTCAGG - Intergenic
949996711 3:9623070-9623092 CCAGCAAACCACCTGAAGCCAGG + Intergenic
950276211 3:11663489-11663511 CAGGCAAATCACCTGAGGTCAGG + Intronic
950390999 3:12696876-12696898 CAGGCAAATCACCTGAGGTCAGG - Intergenic
950512025 3:13435564-13435586 CAGGCAGATCACCTGAAGTCAGG + Intergenic
950691191 3:14659457-14659479 CAGGCAGATCACCTGATGGCAGG + Intronic
950696139 3:14702666-14702688 CAAGCAGATCACCTGAGGTCAGG - Intronic
951196274 3:19827115-19827137 CAGGCAGATCACCTGTGGTCGGG + Intergenic
951391306 3:22107248-22107270 CAGGCAAATCACCTGAGGTCGGG - Intronic
951844286 3:27069025-27069047 CAAGCAGATCACCTGAGGCCAGG + Intergenic
951922689 3:27873434-27873456 CAAGCAAATCACCTGAGGTCAGG + Intergenic
951930658 3:27963435-27963457 CAGGCAGATCACCTGAAGTCAGG - Intergenic
951934753 3:28009919-28009941 CAGGCAGATCACCTGAAGTCGGG + Intergenic
952459268 3:33507162-33507184 CAGGCAAATCACCTGAGGTCAGG - Intronic
952549692 3:34462396-34462418 CAAACAAATCACCTGTAAAAAGG + Intergenic
952633381 3:35497332-35497354 CAAGCAGATCACCTGAGGTCAGG + Intergenic
952930684 3:38358569-38358591 CAGGCAGATCACCTGAAGTCGGG - Intronic
953086984 3:39678785-39678807 CAGGTGAATCACCTGTAGTCAGG - Intergenic
953149898 3:40315300-40315322 CAAGCGAATCACCTGAGGTCAGG + Intergenic
953663078 3:44905211-44905233 CAAGCAGATCACCTGAGGTCAGG - Intronic
953877135 3:46672765-46672787 CAAGCAGATCACCTGAGGTCAGG + Intronic
953935307 3:47036673-47036695 CAGGCAGATCACCTGTGGTCAGG + Intronic
953942187 3:47109756-47109778 CAGGCGGATCACCTGTAGTCAGG + Intronic
953948322 3:47167439-47167461 CAGGCGAATCACCTGAAGTCAGG + Intergenic
953971701 3:47353277-47353299 CAGGCAGATCACCTGAAGTCAGG - Intergenic
954029454 3:47808135-47808157 CAAGCAGATCACCTGAGGTCGGG - Intronic
954034754 3:47845412-47845434 CAGGCAAATCACCTGAGGTCAGG - Intronic
954056531 3:48030569-48030591 CAGGCAGATCACCTGAAGTCAGG + Intronic
954058123 3:48045027-48045049 CAGGCAAATCACCTGAGGTCAGG + Intronic
954308513 3:49745625-49745647 CAGGCAAATCACCTAAAGTCAGG + Intronic
954319652 3:49823058-49823080 CAGGCAAATCACCTGAGGTCAGG + Intergenic
954891016 3:53928322-53928344 CTAGAAAATCACCTGTAGAGTGG + Intergenic
955231796 3:57105856-57105878 CAAGCGAAAGACCTGTAAGCAGG - Exonic
955247799 3:57244381-57244403 CAGGCAGATCACCTGAAGTCAGG - Intronic
955318404 3:57957646-57957668 CAAGAAAATCACCTGAACCCAGG + Intergenic
955373994 3:58378761-58378783 CAGGCGAATCACCTGAAGTCGGG - Intronic
955424670 3:58775967-58775989 CAGGCAGATCACCTGAAGTCGGG - Intronic
956756951 3:72398104-72398126 CAGGCAAATCACCTGAGGTCAGG + Intronic
956822541 3:72966850-72966872 CAGGCAAATCACCTGAGGTCAGG - Intronic
958416752 3:93883370-93883392 CAAGCAGATCACCTGAAGTCAGG + Intronic
958671227 3:97207873-97207895 CAGGCAGATCATCTGTAAGCTGG - Intronic
958702596 3:97613733-97613755 CAAGCAAATCATCAGCAGCCTGG + Intronic
958825106 3:99020883-99020905 CAAGCAGATCACCTGAGGTCAGG - Intergenic
958941351 3:100318878-100318900 CAGGCAGATCACCTGAGGGCAGG - Intronic
959178350 3:102946713-102946735 CAGGCAGATCACCTGAAGTCAGG - Intergenic
959755250 3:109889584-109889606 CAGGCAGATCACCTGAAGTCAGG - Intergenic
959921729 3:111875593-111875615 CAGGCAGATCACCTGAAGTCAGG + Intronic
960620440 3:119631905-119631927 CAGGCAGATCACCTGTGGTCTGG + Intergenic
960798258 3:121511550-121511572 CAGGCAGATCACCTGAAGGCTGG + Intronic
960889386 3:122431382-122431404 CAAGCAAATCACTTGAGGTCAGG - Intronic
960907053 3:122611939-122611961 CAGGCAGATCACCTGAAGTCGGG - Intronic
961505348 3:127367395-127367417 CAAGCAGATCACCTGAGGTCAGG + Intergenic
961693207 3:128685467-128685489 CAGGCAAATCACCTGCAGTTAGG - Intergenic
961736729 3:129006541-129006563 CAAGCAGATCACCTGAGGTCAGG - Intronic
962574488 3:136744098-136744120 CAGGCAGATCACCTGAAGTCAGG + Intronic
963056053 3:141187229-141187251 CAGGCAAATCACCTGAAGTCGGG + Intergenic
963222160 3:142824853-142824875 CAGGCAAATCACCTGAGGTCAGG - Intronic
963245227 3:143052165-143052187 CAGGCAAATCACCTGAGGTCAGG + Intronic
963430386 3:145194388-145194410 CAGGCAGATCACCTGAGGGCGGG + Intergenic
963431481 3:145211096-145211118 CAGGCAGATCACCTGAAGTCAGG + Intergenic
964324438 3:155531395-155531417 CAGGCAAATCACCTGAGGCCAGG + Intronic
964350338 3:155796961-155796983 CAGGCAGATCACCTGAAGTCAGG + Intronic
964487190 3:157198202-157198224 CAGGCAGATCACCTGTGGTCAGG - Intergenic
964867779 3:161280330-161280352 CAGGCAAATCACCTGAGGTCAGG - Intergenic
964957160 3:162374349-162374371 CAAGCAGATCACCTGAGGTCGGG + Intergenic
965412501 3:168349541-168349563 CAGGCAAATCACCTGAGGTCAGG - Intergenic
965573969 3:170199057-170199079 CAGGCAGATCACCTGCAGTCAGG - Intergenic
965585406 3:170313519-170313541 CAGGCAAATCACCTGAGGTCAGG + Intergenic
965595714 3:170408823-170408845 CAGGCAAATCACCTGAGGTCGGG + Intergenic
965752635 3:171992213-171992235 CAGGCAAATCACCTGAGGTCAGG - Intergenic
965916067 3:173847642-173847664 CAGGCAGATCACCTGAGGGCAGG + Intronic
966132709 3:176661552-176661574 CAAGCATATCACTTTCAGGCTGG + Intergenic
966195905 3:177313476-177313498 CAGGCAAATCACCTGAGGTCAGG - Intergenic
966400626 3:179543625-179543647 CAGGCAAATCACCTGAGGTCAGG - Intergenic
966413831 3:179669231-179669253 CAAGCAGATCACCTGAGGTCAGG + Intronic
966874207 3:184312875-184312897 CAGGCAGATCACCTGAAGTCAGG - Intronic
966885378 3:184375013-184375035 CAGGCAGATCACCTGAGGGCAGG - Intronic
966981044 3:185135873-185135895 CAAATAAATCACATGAAGGCAGG + Intronic
966996630 3:185287806-185287828 CAGGCAAATCACCTGAGGTCGGG + Intronic
967521981 3:190442544-190442566 GAATGAAATCATCTGTAGGCTGG - Intronic
967549041 3:190767729-190767751 CAGGCAGATCACCTGTGGTCAGG - Intergenic
968166367 3:196468502-196468524 CAGGCAGATCACCTGAAGTCAGG - Intergenic
968189664 3:196658737-196658759 CAGGCAGATCACCTGAAGTCAGG + Intronic
968281963 3:197484064-197484086 CAAGCGAATCACCTGAACCCAGG + Intergenic
968322804 3:197786340-197786362 CAGGCAGATCACCTGAAGTCAGG - Exonic
968368655 3:198207537-198207559 CAGGCAAATCACCTGAAGTCTGG - Intergenic
968638198 4:1694308-1694330 CAGGCAGATCACCTGAAGTCAGG - Intronic
968781220 4:2583199-2583221 CAGGCAAATCACCTGAGGTCAGG - Intronic
968968326 4:3780768-3780790 TAAGCAACTCAGCTGTTGGCAGG - Intergenic
971984740 4:33807298-33807320 CAGGCAGATCACCTGAAGGCAGG - Intergenic
971997604 4:33985439-33985461 CATGAAAATCACCCTTAGGCGGG + Intergenic
972277333 4:37569424-37569446 CAGGCAGATCACCTGAAGTCAGG - Intronic
972932172 4:44085585-44085607 CAGGCAGATCACCTGAAGTCAGG - Intergenic
973876190 4:55221822-55221844 CATAAAAATCATCTGTAGGCCGG + Intergenic
973896700 4:55420968-55420990 CAGGCAAATCACCTGAGGTCAGG + Intronic
973984727 4:56339521-56339543 CAGGCAGATCACCTGCAGTCAGG + Intronic
974008142 4:56581225-56581247 CAGGCAGATCACCTGAAGTCAGG + Intronic
974176132 4:58327620-58327642 CAAGCAGATCACCTGAGGTCAGG + Intergenic
974540190 4:63224068-63224090 CAGGCAGATCACCTGCAGTCAGG - Intergenic
974748402 4:66105261-66105283 CAGGCAGATCACCTGAAGTCAGG - Intergenic
974802635 4:66838113-66838135 CAGGCAGATCACCTGAAGTCAGG - Intergenic
976057886 4:81090128-81090150 CAAGCAGATCACCTGAAGTCAGG + Intronic
976090503 4:81452335-81452357 CAGGCAGATCACCTGAAGTCGGG - Intronic
976177179 4:82366469-82366491 CAAGCGAATCACCTGAGGTCAGG - Intronic
976542653 4:86295946-86295968 CAAGCAGATCACCTGAGGTCAGG + Intronic
976544942 4:86324177-86324199 CAGGCAGATCACCTGCAGTCAGG + Intronic
976593577 4:86873361-86873383 CAGGCAGATCACCTGTGGTCAGG + Intergenic
976936711 4:90644852-90644874 CAGGCAGATCACCTGTGGTCAGG + Intronic
978428351 4:108605523-108605545 CAGGCAGATCACCTGAAGTCAGG + Intergenic
978437519 4:108701563-108701585 CAAGCTAATCACCTGAGGTCAGG - Intergenic
978540721 4:109813910-109813932 CAGGCAGATCACCTGTGGTCAGG - Intergenic
979257077 4:118617269-118617291 CAGGCAAATCACCCGAAGTCTGG - Intergenic
979331271 4:119423277-119423299 CAGGCAAATCACCCGAAGTCTGG + Intergenic
979862969 4:125717328-125717350 CAAGCAGATCACCTGAGGTCAGG + Intergenic
980730184 4:136813105-136813127 TAAGAAAATCACTTTTAGGCCGG + Intergenic
980839292 4:138237978-138238000 CAAGCAGATCACCTGAGGTCGGG - Intronic
981023645 4:140054140-140054162 CAGGCAGATCACCTGAAGTCAGG + Intronic
981445198 4:144828672-144828694 CAGGCAAATCACCTGAGGTCAGG + Intergenic
981671205 4:147289124-147289146 CAGGCAGATCACCTGAAGTCAGG + Intergenic
981706509 4:147664885-147664907 CAAGCAGATCACCTGAGGTCGGG + Intronic
981783360 4:148450680-148450702 CAGGCAGATCACCTGAAGTCGGG + Intergenic
981806957 4:148727857-148727879 CAGGCAAATCACCTGAGGTCAGG - Intergenic
981987258 4:150873361-150873383 CAGGCAGATCACCTGAAGTCAGG + Intronic
981992490 4:150939430-150939452 CCAGCAAATCACCAGAAGTCAGG + Intronic
982410510 4:155071127-155071149 CAAGCAGATCACCTGAGGTCAGG - Intergenic
983391351 4:167134258-167134280 CAGGCAGATCGCCTGTAGTCAGG - Intronic
983526374 4:168764353-168764375 TAAGTAAATCACCTCTAGGCTGG + Intronic
983560044 4:169091820-169091842 CAAGCAGATCACCTGAGGTCGGG - Intergenic
983876932 4:172887789-172887811 CAGGCAGATCACCTGTGGTCAGG - Intronic
984120664 4:175738163-175738185 CAGGCAAATCACCTGAGGGCAGG - Intronic
984298982 4:177890773-177890795 CAAGCAGATCACCTGAGGCCAGG - Intronic
984478530 4:180268438-180268460 CAACCAAGTCATCTGTAGGCAGG - Intergenic
984537909 4:181000244-181000266 CGAGCAAATCACCTGAGGTCAGG - Intergenic
984871631 4:184330593-184330615 CAGGCAGATCACCTGAAGTCAGG + Intergenic
985228915 4:187794080-187794102 CAAGCCAATCACCTGAGGTCAGG - Intergenic
985267828 4:188166455-188166477 CAAGCGAATCACCTGAGGTCGGG - Intergenic
986246270 5:6009885-6009907 CAGGTGAATCACCTGAAGGCAGG + Intergenic
986686797 5:10281930-10281952 CAGGCAGATCACCTGAAGTCAGG + Intronic
987184987 5:15408063-15408085 CAGGCAGATCACCTGAAGTCAGG - Intergenic
987379028 5:17266577-17266599 CAAGCGAATCACCTGAGGTCAGG + Intronic
987467794 5:18292890-18292912 CGAGCAAATCACCTGAGGTCAGG - Intergenic
987680481 5:21130067-21130089 CAGGCAGATCACCTGTGGTCAGG - Intergenic
987967209 5:24892542-24892564 CAAGCATATCACCTGAGGTCAGG - Intergenic
988276464 5:29087373-29087395 CAGGCAAATCACCTGAGGTCGGG - Intergenic
988543592 5:32135945-32135967 CAAGCAGATCACTTGAAGCCAGG + Intronic
988668813 5:33359448-33359470 CAGGCAGATCACCTGAAGTCAGG + Intergenic
988713145 5:33798665-33798687 CAGGCAGATCACCTGAAGTCAGG - Intronic
988800820 5:34695125-34695147 CAGGCAAATCACCTGAGGTCAGG - Intronic
989054425 5:37353353-37353375 CAGGCAAATCACCTGAGGTCAGG + Intronic
989055514 5:37362513-37362535 CAGGCAGATCACCTGCAGTCGGG - Intronic
989237519 5:39166207-39166229 CAAGCAGATCACCTGAGGTCAGG + Intronic
989530070 5:42497829-42497851 AATGCAAATCACCTGTAAACAGG - Intronic
989595070 5:43149050-43149072 CGAGCAAATCACCTGAGGTCAGG + Intronic
990095276 5:52103760-52103782 CAGGCAGATCACCTGTAGTCAGG - Intergenic
990567692 5:57046106-57046128 CAAGCAGATCACCTGAATTCAGG + Intergenic
990797565 5:59561700-59561722 CAGGCAGATCACCTGTGGTCAGG + Intronic
990806061 5:59663396-59663418 CAAGCGGATCACCTGAAGTCAGG - Intronic
991110879 5:62897688-62897710 CTAGAAATTCACCTGTAGTCTGG + Intergenic
991151215 5:63373072-63373094 CAGGCAGATCACCTGAAGTCAGG + Intergenic
991399897 5:66241262-66241284 CAAGAAAATCACCCGTTGGCCGG - Intergenic
991774838 5:70074763-70074785 CAGGCGAATCACCTGAAGTCGGG + Intronic
991922158 5:71667763-71667785 CAGGCAGATCACCTGAAGTCAGG - Intergenic
992014977 5:72566559-72566581 CAGGCAGATCACCTGAAGTCAGG + Intergenic
992291117 5:75281102-75281124 CAGGCAGATCACCTGAAGTCAGG + Intergenic
992592850 5:78313480-78313502 CAAGCAGATCACCTGAGGTCGGG + Intergenic
992788993 5:80197119-80197141 CAGGCAAATCACCTGAGGTCAGG + Intronic
992897485 5:81258125-81258147 CCAGCAGATCACCTGTGGTCAGG - Intronic
992907757 5:81362974-81362996 CAGGCAGATCACCTGTGGTCAGG + Intronic
993141726 5:84042507-84042529 CAGGCAGATCACCTGAAGTCAGG - Intronic
993407638 5:87531350-87531372 GAAGCAAATCACCTGGTGGAAGG + Intergenic
993648560 5:90489877-90489899 CAAGCAGATCACCTGAGGTCAGG + Intronic
993871203 5:93256492-93256514 CCAGCAAATCACCAGAAGCCAGG + Intergenic
993958404 5:94265569-94265591 CAGGCAAATCACCTGAGGTCAGG + Intronic
994191554 5:96874945-96874967 CAAACAAAACAACTATAGGCTGG + Intronic
994218551 5:97167142-97167164 CAGGCAAATCACCTGAGGTCAGG - Intronic
995379740 5:111518570-111518592 CAAGCAGATCACCTGAGGTCAGG - Intergenic
995572390 5:113494060-113494082 CAGGCAAATCACCTGAGGTCAGG + Intergenic
995834336 5:116385406-116385428 CAAGCAGATCACCTGAGGTCGGG - Intronic
996066969 5:119090246-119090268 CAGGCAAATCACCTGAGGTCCGG - Intronic
996411906 5:123167614-123167636 CAAGCAGATCACCTGAGGTCGGG - Intronic
996664717 5:126045792-126045814 CAGGCAAATCACCTGAGGTCAGG + Intergenic
996702573 5:126465110-126465132 GCAGCAGATCACCTGGAGGCTGG - Intronic
996949485 5:129108737-129108759 CAAGTAAATCACCTGAGGTCAGG - Intronic
997130154 5:131268677-131268699 CAGGCAGATCACCTGAAGTCGGG - Intronic
997244371 5:132334034-132334056 CAGGCAAATCACCTGAGGTCAGG - Intronic
997766537 5:136510050-136510072 CAAGCAGATCACCTGAGGTCAGG + Intergenic
998085566 5:139319618-139319640 CAGGCAAATCACCTGAGGTCAGG + Intronic
998193616 5:140047093-140047115 CAGGCAGATCACCTGAAGTCAGG - Intergenic
998419727 5:141972816-141972838 CGGGCAAATCACCTGCAGTCAGG - Intronic
998442207 5:142172111-142172133 CAAGCAGATCACCTGAGGTCGGG + Intergenic
998724330 5:144992229-144992251 CAGGCAAATCACCTGAGGTCAGG - Intergenic
998867905 5:146523572-146523594 AAAACAAAACACCTGTAGCCAGG - Intergenic
999152676 5:149436719-149436741 CAAGCAGATCACCTGAGGTCAGG + Intergenic
999340855 5:150770380-150770402 CGAGCAGATCACCTGAAGTCAGG + Intergenic
999728263 5:154455143-154455165 CAGGCAGATCACCTGAAGTCAGG - Intronic
1000152312 5:158515367-158515389 CAAGCAGATCACCTGAGGTCAGG + Intergenic
1000317916 5:160110802-160110824 CAAGCAGATCACCTGAGGTCGGG + Intronic
1000322443 5:160145554-160145576 CGAGCAGATCACCTGAAGTCAGG + Intergenic
1000528206 5:162385236-162385258 CAGGCAGATCACCTGTGGTCGGG + Intergenic
1000544869 5:162586733-162586755 CAAGCGGATCACCTGAAGTCAGG + Intergenic
1000864144 5:166492151-166492173 CAGGCAAATCACCTGAGGTCAGG + Intergenic
1001048667 5:168396154-168396176 CAGGCAGATCACCTGCAGTCAGG + Intronic
1001139827 5:169135337-169135359 CAGGCAGATCACCTGAGGGCAGG - Intronic
1001160665 5:169309946-169309968 CAAGCAGATCACCTGAGGTCAGG + Intergenic
1001909570 5:175504345-175504367 CAGGCAAATCACCTGAGGTCAGG + Intronic
1002032180 5:176438444-176438466 CAGGCAAATCACCTGAGGTCAGG - Intergenic
1002262199 5:178001504-178001526 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1002350654 5:178581336-178581358 CAGGCAAATCACCTGAGGTCAGG + Intronic
1002694962 5:181081076-181081098 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1002727933 5:181313102-181313124 CAGGCAAATCACCTGAAGTCTGG - Intergenic
1003197072 6:3924807-3924829 CAGGCAAATCACCTGAGGTCAGG + Intergenic
1003212729 6:4081537-4081559 CCAGCAGATCACCTGAAGTCAGG - Intronic
1003576747 6:7303756-7303778 CAGGCAGATCACCTGAAGTCAGG + Intronic
1003823218 6:9923663-9923685 CTAGCAAATCATCTTCAGGCAGG + Intronic
1003895766 6:10606085-10606107 CAAGCAGATCACCTGAGGTCAGG + Intronic
1003947949 6:11092546-11092568 CGAGCAGATCACCTGAAGTCAGG - Intergenic
1003972043 6:11309024-11309046 CCAGGTAGTCACCTGTAGGCAGG - Intronic
1004119429 6:12805826-12805848 CAGGCAGATCACCTGAAGTCAGG - Intronic
1004146412 6:13071197-13071219 CAAGCAGATCACCTGAGGTCAGG + Intronic
1004196676 6:13511694-13511716 CAGGCAAATCACCTGAGGTCAGG - Intergenic
1004203436 6:13570918-13570940 CAAGCAGATCACCTGAGGTCAGG + Intergenic
1004345192 6:14842958-14842980 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1004380313 6:15127062-15127084 CAGGCAAATCACCTGAGGTCAGG - Intergenic
1004666748 6:17755199-17755221 CAGGCAAATCACCTGAGGTCAGG - Intergenic
1005174329 6:23026851-23026873 CAAGCAGATCACCTGAGGTCGGG - Intergenic
1005267055 6:24123172-24123194 CAGGCAAATCACCTGAGGTCGGG + Intergenic
1005317734 6:24620526-24620548 CAGGCAAATCACCTGAGGTCAGG - Intronic
1005986533 6:30879331-30879353 CAGGCAGATCACCTGAAGTCAGG - Intronic
1006125236 6:31833626-31833648 CAGGCAAATCACCTGAAGTCAGG + Intergenic
1006128756 6:31855781-31855803 CAAGCGAATCACCTGAAGTCAGG - Intergenic
1006355685 6:33555998-33556020 CAGGCAAATCACCTGAGGTCGGG - Intergenic
1006533112 6:34674252-34674274 CAGGCAAATCACCTGAGGTCAGG - Intronic
1006547053 6:34788936-34788958 CAGGCAGATCACCTGTGGTCAGG + Intergenic
1006549058 6:34805363-34805385 CAAGCAGATCACTTGAAGTCAGG + Intronic
1006869554 6:37238901-37238923 CAGGCAGATCACCTGAAGTCAGG + Intronic
1007126582 6:39430984-39431006 TAAGCAAATCTCTTCTAGGCTGG + Intronic
1007517325 6:42423064-42423086 CAAGCAGATCACCTGAGGTCAGG - Intronic
1007534434 6:42572930-42572952 CAAGCAGATCACCTGAGGTCAGG - Intronic
1008659612 6:53652450-53652472 CCAGCACCTCACCTGGAGGCTGG + Intronic
1009707904 6:67278307-67278329 CAGGCAAATCACCTGAGGTCAGG - Intergenic
1010247237 6:73673036-73673058 CAAGCAGATCACCTGAGGTCAGG - Intergenic
1010910596 6:81550332-81550354 CAGGCAAATCACTTGAAGCCAGG + Intronic
1010963690 6:82177639-82177661 CAGGCAAATCACCTGAGGTCGGG - Intronic
1011531781 6:88331048-88331070 CAGGCAAATCACCTGAGGTCAGG + Intergenic
1011597837 6:89033123-89033145 CAAGCAGATCACTTGTGGTCAGG - Intergenic
1011743488 6:90386981-90387003 CAAGCAAATCAGCTGGGGACTGG + Intergenic
1011785178 6:90835745-90835767 CAAGCGAAACACCTGCAGTCTGG - Intergenic
1012037202 6:94157553-94157575 CAAGCAGATCACCTGAGGTCAGG + Intergenic
1012078884 6:94729668-94729690 CAAGCGGATCACCTGAAGTCAGG + Intergenic
1013104997 6:107019620-107019642 CAGGCAGATCACCTGTAGTTGGG - Intergenic
1013392405 6:109699729-109699751 CAGGCAAATCACTTGAAGTCAGG - Intronic
1013476553 6:110512249-110512271 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1013508514 6:110822885-110822907 CAGGCAGATCACCTGGAGGTCGG + Intronic
1013790669 6:113833044-113833066 CAAGCAGATCACCTGAGGTCAGG + Intergenic
1013802849 6:113967354-113967376 CAGGCAAATCACCTGAGGTCGGG - Intronic
1014918994 6:127190194-127190216 CAAGCAAATCACCTGATATCAGG + Intronic
1014988099 6:128036957-128036979 CAGGCAAATCACCTGAGGTCAGG - Intronic
1015267440 6:131302670-131302692 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1015532087 6:134230784-134230806 CAGGCAAATCACTTGAAGTCAGG + Intronic
1015533415 6:134243594-134243616 CAAGCAGATCACCTGAGGCCAGG - Intronic
1015740655 6:136449959-136449981 CAAGCAGATCACCTGAGGTCAGG + Intronic
1015746409 6:136514355-136514377 CAAGCAGATCACCTGAGGTCAGG + Intronic
1015842425 6:137489285-137489307 CAAGCTCTTCACGTGTAGGCAGG - Intergenic
1015890548 6:137965865-137965887 CAAGCAGATCAACTCTAGGAAGG - Intergenic
1016417438 6:143847586-143847608 CAGGCAGATCACCTGAAGTCGGG - Intronic
1016703675 6:147082176-147082198 CAAGCAGATCACCTGAGGTCAGG + Intergenic
1016807585 6:148227583-148227605 CAGGCAAATCACCTGAGGTCAGG - Intergenic
1016956939 6:149635827-149635849 CAAGCAGATCACCTGAGGTCAGG + Intronic
1017071785 6:150581505-150581527 CAGGCAAATCACCTGAGGTCGGG - Intergenic
1017148528 6:151256874-151256896 CAGGCAGATCACCTGAAGTCAGG - Intronic
1017319886 6:153078099-153078121 CAGGCAAATCACCTGAGGTCAGG - Intronic
1017332480 6:153215913-153215935 CGGGCAAATCACCTGAAGTCAGG + Intergenic
1017384726 6:153870087-153870109 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1017393511 6:153968882-153968904 CAGGCAAATCACCTGAGGTCGGG + Intergenic
1017441459 6:154467985-154468007 CAGGCAAATCACCTGAGGTCAGG - Intronic
1018131182 6:160733610-160733632 CAAGCAGATCACCTGAGGTCAGG + Intronic
1018145143 6:160878966-160878988 CAAGCAGATCACCTGAGGTCAGG + Intergenic
1018205482 6:161433787-161433809 CAAGCAGATCACCTGAGGTCAGG + Intronic
1018967952 6:168503303-168503325 CAGGCAAATCACCTGAGGTCAGG - Intronic
1019380839 7:722462-722484 CAGGCAGATCACCTGTGGTCAGG - Intronic
1020031469 7:4935955-4935977 CAAGCAGATCACCTGAGGTCAGG + Intronic
1020050583 7:5079024-5079046 CAGGCAAATCACTTGAAGTCAGG - Intergenic
1020197852 7:6056063-6056085 CAAGCAGATCACCTGAGGTCAGG + Intronic
1020201969 7:6086953-6086975 CAGGCAAATCACCCGAAGTCAGG - Intergenic
1020344812 7:7151594-7151616 AAAGCCAATCACCTGTAAGTGGG + Intergenic
1020349757 7:7206445-7206467 CAGGCGAATCACCTGAAGTCGGG + Intronic
1020511149 7:9058719-9058741 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1020686980 7:11308479-11308501 CAGGCAGATCACCTGTGGTCAGG + Intergenic
1020735120 7:11938739-11938761 CAGGCAGATCACCTGCAGTCAGG - Intergenic
1020986076 7:15136218-15136240 CAAGCAGATCACCTGAGGTCAGG - Intergenic
1021037230 7:15815116-15815138 CAGGCAAATCACCTGAGGTCAGG + Intergenic
1021768937 7:23979038-23979060 CAAGCAATTCTCCTGTAGCTGGG + Intergenic
1021802443 7:24320704-24320726 CAAGCAGATCACCTGAGGTCAGG - Intergenic
1021886558 7:25145189-25145211 CAGGCAAATCACCTGAGGTCAGG - Intronic
1021991471 7:26145584-26145606 CAAGCAAATCACTTGAGGCCAGG + Intergenic
1022023808 7:26427033-26427055 CAAGCAGATCACCTGAGGTCAGG + Intergenic
1022047563 7:26634588-26634610 CACACAAATTACCTGCAGGCAGG - Intergenic
1022189269 7:28001124-28001146 CAGGCAAATCACTTGAAGTCAGG + Intronic
1022554055 7:31273713-31273735 CAAGCAGATCACCTGAGGTCGGG - Intergenic
1023399046 7:39778526-39778548 CAGGCAAATCACCTGAAGTCAGG - Intergenic
1023763399 7:43488080-43488102 CAGGCAGATCACCTGAAGTCAGG + Intronic
1024002242 7:45198065-45198087 CAAGCAGATCACCTGAGGTCAGG + Intergenic
1024072000 7:45794349-45794371 CAGGCAAATCACCTGAAGTCTGG - Intergenic
1024170570 7:46781090-46781112 CAGGCAGATCACCTGGAGTCAGG + Intergenic
1024284799 7:47747827-47747849 CAAGTAAATCACCTGAGGTCAGG - Intronic
1024546459 7:50525534-50525556 CAGGCAGATCACCTGCAGTCAGG + Intronic
1024651397 7:51406171-51406193 CAGGCAAATCACCTGAAGTCAGG + Intergenic
1024653120 7:51425770-51425792 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1024810532 7:53206591-53206613 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1025133601 7:56391980-56392002 CAGGCAAATCACCTGAAGTCAGG + Intergenic
1025147512 7:56517632-56517654 CAGGCAAATCACCTGAGGTCAGG - Intergenic
1025614792 7:63108531-63108553 CATGCAAATCAACTGCAGGCTGG + Intergenic
1025947848 7:66118201-66118223 CAGGCAAATCACCTGAGGTCAGG - Intronic
1026069747 7:67108102-67108124 CAGGCAAATCACTTGAAGTCAGG - Intronic
1026198563 7:68194293-68194315 CAAGCAGACCACCTGCAGTCAGG - Intergenic
1026229548 7:68471062-68471084 CAAGGAAGGCACCTGGAGGCGGG - Intergenic
1026357330 7:69569949-69569971 CAGGCAAATCACCTGAGGTCAGG + Intergenic
1026393063 7:69921836-69921858 CAGGCAGATCACCTGAGGGCAGG + Intronic
1026707158 7:72704204-72704226 CAGGCAAATCACTTGAAGTCAGG + Intronic
1027005815 7:74692002-74692024 CAAGCAGATCACCTGAGGTCAGG - Intronic
1027130985 7:75591258-75591280 CAAGCAGATCACCTGAGGCCAGG - Intronic
1027386516 7:77664381-77664403 CAAGCAGATCACCTGAGGTCAGG - Intergenic
1027392290 7:77716856-77716878 CAAGCAGATCACCTGAAGTCAGG - Intronic
1027468530 7:78544884-78544906 CAGGCAAATCACCTGAAGTCAGG - Intronic
1028197315 7:87921875-87921897 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1028305580 7:89259753-89259775 CAGGCAGATCACCTGAAGTCAGG + Intronic
1029031620 7:97474108-97474130 CCAGCAGATCACCTGAAGTCAGG + Intergenic
1029149278 7:98468645-98468667 CAGGCAAATCACCTGAGGTCAGG - Intergenic
1029584624 7:101462542-101462564 CAGGCAGATCACCTGAAGTCAGG - Intronic
1029598947 7:101552677-101552699 CAGGCAGATCACCTGAAGTCAGG + Intronic
1029624391 7:101710928-101710950 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1029651854 7:101898816-101898838 CAGGCAGATCACCTGTGGTCAGG - Intronic
1029653279 7:101908371-101908393 CGAGCAAATCACCTGAGGTCAGG - Intronic
1029743584 7:102504770-102504792 CAGGCAGATCACCTGAGGGCAGG + Intronic
1029851381 7:103464935-103464957 CAGGCAAATCACCTGAGGTCAGG - Intergenic
1029983392 7:104899957-104899979 CAGGCAAATCACCTGAGGTCAGG - Intronic
1030027195 7:105335724-105335746 CAGGCAAATCACCTGAGGTCGGG + Intronic
1030372954 7:108720977-108720999 CTAGAAAATCACCTGTAGAGTGG - Intergenic
1031135684 7:117881474-117881496 CAGGCAAATCACTTGAAGTCAGG - Intergenic
1032041083 7:128562641-128562663 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1032105067 7:129021126-129021148 CAGGCAGATCACCTGAAGTCAGG + Intronic
1032138969 7:129309002-129309024 CAGGCAGATCACCTGAAGTCAGG + Intronic
1032150060 7:129421021-129421043 CAGGCAGATCACCTGAAGTCAGG + Intronic
1032230876 7:130072981-130073003 CAGGCAAATCACCTGAGGTCAGG - Intronic
1032407478 7:131667168-131667190 CAGGCAGATCACCTGAAGTCGGG - Intergenic
1032696376 7:134340108-134340130 CAGGCAAATCACCTGAGGTCAGG - Intergenic
1033129196 7:138731160-138731182 CAGGCAGATCACCTGAAGTCAGG - Intronic
1033224236 7:139548106-139548128 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1033305843 7:140224807-140224829 CAAGCAGATCACCTGAGGTCAGG + Intergenic
1033312819 7:140274217-140274239 CAAGCAGATCACCTGAGGTCAGG - Intergenic
1033519067 7:142141725-142141747 CAGGCAAATCACCTGAGGTCAGG - Intronic
1033607013 7:142934966-142934988 CAAGCAGATCACCTGAGGTCAGG - Intergenic
1033903337 7:146170251-146170273 CAAGCAGATCACCTGAGGTCAGG - Intronic
1034121615 7:148633151-148633173 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1034335321 7:150319432-150319454 CAGGCAAATCACCTGAGGTCAGG - Intronic
1034628622 7:152513565-152513587 CAAGCAGATCACCTGAGGTCAGG + Intergenic
1034639483 7:152591277-152591299 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1035174263 7:157039305-157039327 CAGGCAGATCACCTGAACGCAGG + Intergenic
1035176256 7:157054049-157054071 CAGGCAAATCACCTGAGGTCAGG - Intergenic
1035179990 7:157082257-157082279 CGAGCAAATCACCTGAGGTCAGG + Intergenic
1035887908 8:3311475-3311497 CAAGCAAATCACTTGAGGTCAGG - Intronic
1035891773 8:3352610-3352632 CAGGCAGATCACCTGAAGTCAGG + Intronic
1036161072 8:6388955-6388977 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1036443724 8:8803742-8803764 CAGGCAAATCACCTGAGGTCAGG + Intronic
1036599200 8:10243501-10243523 CAAGCAATTCACTTGTAAACTGG + Intronic
1036946991 8:13103609-13103631 CAGGCAGATCACCTGAAGTCAGG + Intronic
1037049953 8:14360551-14360573 CAGGCAGATCACCTGAAGTCAGG - Intronic
1037057068 8:14456179-14456201 CAGGCAAATCACCTGAGGTCAGG + Intronic
1037258807 8:16984363-16984385 CAAGCAGATCACCTGAGGTCAGG + Intergenic
1037263111 8:17029246-17029268 CAAGCAGATCACCTGAGGTCAGG + Intronic
1037870934 8:22495784-22495806 CAGGCAGATCACCTGAAGTCAGG - Intronic
1038212387 8:25531402-25531424 CAAGCAAATCACTTGAGGTCAGG + Intergenic
1038573735 8:28686091-28686113 CAAGCAAATCACTTGAGGTCAGG - Intronic
1038686172 8:29720377-29720399 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1038710612 8:29940947-29940969 CAAGCAGATCACCTGAGGTCAGG + Intergenic
1038749228 8:30280619-30280641 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1038973705 8:32667983-32668005 CAAGCGGATCACCTGAGGGCAGG + Intronic
1038982161 8:32771793-32771815 CAGGCAAATCACCTGAGGTCAGG + Intergenic
1039515265 8:38127449-38127471 AAAGTTAATCACATGTAGGCTGG + Intronic
1039531321 8:38265653-38265675 CAGGCGGATCACCTGTAGTCAGG - Intronic
1039683192 8:39764784-39764806 CAGGCAGATCACCTGTGGTCAGG + Intronic
1039809105 8:41028747-41028769 CAAGCAGATCACCTGAGGTCAGG - Intergenic
1039813321 8:41069727-41069749 CAAGCAGATCACCTGAGGTCAGG + Intergenic
1039867724 8:41520167-41520189 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1040918670 8:52591660-52591682 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1040920565 8:52612100-52612122 CAGGCAAATCACTTGAAGTCAGG - Intergenic
1041034975 8:53779929-53779951 CAGGCGGATCACCTGAAGGCAGG + Intronic
1041071217 8:54127673-54127695 CAGGCATATCACCTGAAGTCAGG + Intergenic
1041288875 8:56289179-56289201 CAGGCAGATCACCTGAAGTCGGG - Intergenic
1041745151 8:61200346-61200368 CAGGCAGATCACCTGAAGTCAGG - Intronic
1041833849 8:62188450-62188472 CAGGCAAATCACCTGAGGTCAGG + Intergenic
1042291313 8:67171773-67171795 CAGGCAAATCACCTGAGGTCAGG - Intronic
1042522070 8:69723998-69724020 CAGGCAAATCACCTGAAGTCAGG - Intronic
1042603478 8:70523104-70523126 CAAGTGAATCACTTGAAGGCAGG + Intergenic
1043115829 8:76252796-76252818 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1043176849 8:77032175-77032197 GAAGAAAATAACCTGTTGGCAGG + Intergenic
1043465375 8:80501091-80501113 CAAGCAGATCACCTGAGGTCAGG - Intronic
1043939965 8:86186302-86186324 CAGGCAAATCACCTGAGGTCAGG + Intergenic
1044621525 8:94195228-94195250 CAGGCAGATCACCTGAAGTCAGG - Intronic
1044678955 8:94757881-94757903 CAGGCAAATCACCTGAGGTCAGG + Intronic
1044993893 8:97820952-97820974 CAGGCAAATCACCTGAGGTCAGG - Intronic
1045220276 8:100192235-100192257 CAGGCAAATCACCTGAGGTCAGG + Intronic
1045361306 8:101436231-101436253 CCAGCAAATCACCTGAGGCCAGG - Intergenic
1045374453 8:101557449-101557471 CAGGCGAATCACCTGTGGTCAGG - Intronic
1045460304 8:102419624-102419646 CAGGCAAATCACCTGAGGTCAGG + Intergenic
1045512658 8:102824922-102824944 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1045517856 8:102876474-102876496 CAGGCAAATCACCTGAGGTCAGG + Intronic
1045782048 8:105876846-105876868 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1046061346 8:109143564-109143586 CAGGCAGATCACCTGAAGTCGGG - Intergenic
1046498819 8:115048604-115048626 CAGGCAAATCACCTGAGGTCAGG - Intergenic
1046978916 8:120315140-120315162 CAGGCAGATCACCTGAAGTCAGG + Intronic
1046999556 8:120560253-120560275 CAGGCAGATCACCTGAAGTCAGG + Intronic
1047040750 8:120992458-120992480 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1047102399 8:121692458-121692480 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1047263879 8:123287272-123287294 CAAGCCAATCACCTGAGGTCAGG - Intergenic
1047437103 8:124843832-124843854 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1047487596 8:125345926-125345948 CAGGCAGATCACCTGAGGGCAGG + Intronic
1047834637 8:128675102-128675124 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1047914888 8:129572420-129572442 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1047956406 8:129979686-129979708 CAAGCAGATCACCTGAAGTCAGG + Intronic
1048477368 8:134755582-134755604 CAAGCAGATCACCTGAGGTCAGG + Intergenic
1048866393 8:138764729-138764751 CAGGCAAATCACCTGAGGTCAGG + Intronic
1048874163 8:138823631-138823653 CAGGCAAATCACCTGAGGTCAGG - Intronic
1049077588 8:140411567-140411589 CAGGCAGATCACCTGAAGTCAGG - Intronic
1049117356 8:140700701-140700723 CAAGCAGATCACCTGAGGTCAGG - Intronic
1049158302 8:141080991-141081013 CAGGCAGATCACCTGTGGTCGGG - Intergenic
1049198409 8:141327954-141327976 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1049511273 8:143027989-143028011 CAGGCAAATCACTTGAAGTCAGG - Intergenic
1049794473 8:144490277-144490299 CAGGCAAATCACCTGAGGTCAGG + Intronic
1049948303 9:619907-619929 CGAGCAGATCACCTGAAGTCAGG + Intronic
1049967647 9:793779-793801 ACAAGAAATCACCTGTAGGCCGG - Intergenic
1050307830 9:4323260-4323282 CAGGCAAATCACCTGAGGTCAGG - Intronic
1051427224 9:16944744-16944766 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1051558239 9:18409154-18409176 CAGGCAAATCACCTGAGGTCAGG + Intergenic
1051644950 9:19258880-19258902 CAGGCAAATCACCTGAGGTCAGG - Intronic
1051783205 9:20712958-20712980 CAGGCAGATCACCTGAAGTCAGG - Intronic
1053177112 9:35934696-35934718 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1053195952 9:36118727-36118749 CAAACAAATCACATTTAGCCTGG - Intronic
1053254945 9:36608808-36608830 CAGGCAAATCACCTGAGGTCGGG - Intronic
1053388740 9:37717605-37717627 CAGGCAGATCACCTGAAGCCAGG - Intronic
1054708854 9:68490580-68490602 CAAGCAGATCACCTGAGGTCAGG - Intronic
1054857761 9:69919129-69919151 CAAGCAGATCACCTGAGGCCAGG - Intergenic
1054877756 9:70114240-70114262 TAAGCAAATGACATGTGGGCTGG + Intronic
1054881225 9:70147026-70147048 CAGGCATATCACCTGTGGTCAGG + Intronic
1055095507 9:72409311-72409333 CAAGCAGATCACCTGAGGTCAGG - Intergenic
1055161105 9:73129164-73129186 CCAGCAAACCACCAGAAGGCAGG + Intergenic
1055293838 9:74813867-74813889 CAGGCATATCACCTGTGGTCAGG + Intronic
1055443625 9:76361115-76361137 CAGGCAGATCACCTGAAGTCAGG + Exonic
1055452255 9:76441371-76441393 CAGGCAGATCACCTGAAGTCAGG - Intronic
1055690698 9:78827274-78827296 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1055776375 9:79770713-79770735 CAGGCGAATCACCTGAAGTCAGG + Intergenic
1056052811 9:82787875-82787897 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1056463646 9:86832382-86832404 ATAGCAAATCACGTGTTGGCTGG - Intergenic
1056598065 9:88023996-88024018 CAGGCAAATCACCTGAGGTCAGG - Intergenic
1056674085 9:88658547-88658569 CAAGCAAATCTCCTTTTGGATGG - Intergenic
1057741093 9:97711647-97711669 CAAGCATGTCCGCTGTAGGCAGG - Intergenic
1058280374 9:103105539-103105561 CAGGCAAATCACCTGAGGTCAGG - Intergenic
1058440645 9:105003575-105003597 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1058461368 9:105187054-105187076 CAGGCAAATCACCTGAGGTCGGG - Intergenic
1058755185 9:108077220-108077242 CAACCATATCACCTGAGGGCAGG - Intergenic
1058823891 9:108757945-108757967 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1058904538 9:109471283-109471305 CAGGCAAATCACCTGAGGTCAGG - Intronic
1058961927 9:109999654-109999676 CACGCAAAGCACCTGTGGGCAGG - Intronic
1058975298 9:110120730-110120752 CAGGCAAATCACCTGAGGTCAGG - Intronic
1059231051 9:112721879-112721901 CAAGCAAATCACCTGAGGTCGGG + Intergenic
1059318037 9:113443894-113443916 CAAGCAAATCACCTGAGGTCAGG - Intergenic
1059440402 9:114303533-114303555 CATGAAAAGCACCTGTAGCCCGG - Intronic
1059513192 9:114868595-114868617 CAAGCAAATCACCTGAGGTCAGG - Intergenic
1059977692 9:119735823-119735845 CAGGCAGATCACCTGAAGTCGGG + Intergenic
1060118346 9:120964363-120964385 CAAGCAATTCTCCTGTAGTTAGG - Intronic
1060448534 9:123714952-123714974 CAGGCAAATCACCTGAGGTCAGG + Intronic
1060662484 9:125412481-125412503 CAGGCAAATCACCTGAGGTCAGG + Intergenic
1060791329 9:126487530-126487552 CAAGCAGATCACCTGAGGTCAGG + Intronic
1061174127 9:128982201-128982223 CAGGCAAATCACTTGAAGCCAGG + Intronic
1061206646 9:129167829-129167851 CGAGCAGATCACCTGAAGTCAGG - Intergenic
1061494880 9:130967175-130967197 CGAGCAGATCACCTGAGGGCGGG + Intergenic
1061639903 9:131944757-131944779 CAAGCAGATCACCTGAGGTCAGG - Intronic
1061754175 9:132801153-132801175 CAGGCAGATCACCTGAAGTCAGG - Intronic
1061984181 9:134119822-134119844 CAGGCAGATCACCTGAGGGCGGG + Intergenic
1062102370 9:134734981-134735003 CAGGCAGATCACCTGAAGTCAGG + Intronic
1062441845 9:136573434-136573456 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1062752996 9:138270243-138270265 CAGGCAAATCACCTGAAGTCTGG - Intergenic
1203575512 Un_KI270745v1:5020-5042 CAGGCAAATCACCTGAAGTCTGG - Intergenic
1185720107 X:2374509-2374531 CAGGCAAATCACCTGAGGTCGGG + Intronic
1185741706 X:2538700-2538722 CAAGCAGATCACCTGAGGTCAGG + Intergenic
1186351150 X:8741287-8741309 CGGGCAAATCACCTGAAGTCGGG - Intergenic
1186577327 X:10780191-10780213 CAAGCAGATCACCTGAGGTCAGG - Intronic
1186872380 X:13785513-13785535 CAGGCAGATCACCTGAAGTCAGG - Intronic
1187335563 X:18378264-18378286 CAGGCAAATCACCTGAGGTCAGG + Intergenic
1187462658 X:19501836-19501858 CAAGCAGATCACCTGAGGTCAGG + Intronic
1187850019 X:23582606-23582628 CAGGCAAATCACCTGAGGTCAGG + Intergenic
1187880611 X:23843809-23843831 CAGGCAAATCACCTGTGGTCGGG - Intronic
1188663229 X:32787144-32787166 CTAGCAAGTCTCCTGAAGGCTGG - Intronic
1188746751 X:33854481-33854503 CAGGCGAATCACCTGAAGCCAGG - Intergenic
1189101499 X:38195098-38195120 CAGGCAGATCACCTGAAGTCAGG - Intronic
1189118450 X:38368131-38368153 CAGGCAAATCACCTGAGGTCGGG + Intronic
1189289458 X:39875012-39875034 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1189495814 X:41507851-41507873 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1189522366 X:41783335-41783357 CAAGCAGATCACCTGAGGTCAGG + Intronic
1189538518 X:41962226-41962248 CAGGCAAATCACCTGAGGTCAGG - Intergenic
1189576409 X:42358545-42358567 CAAGCAGATCACCTGAGGACAGG - Intergenic
1189605996 X:42678523-42678545 CAGGCAAATCACCTGAGGTCGGG + Intergenic
1189742639 X:44136076-44136098 CAAGCAGATCACCTGAGGTCAGG + Intergenic
1189827145 X:44931295-44931317 CAGGCAGATCACCTGAAGTCAGG - Intronic
1189864072 X:45305769-45305791 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1190087051 X:47404390-47404412 CAAGCAGATCACCTGAGGTCAGG - Intronic
1190213294 X:48464566-48464588 CAAGCAGATCACCTGAGGTCAGG + Intronic
1190280936 X:48929491-48929513 CAGGCAGATCACCTGAAGTCAGG + Intronic
1190582094 X:51899364-51899386 CAGGCAGATCACCTGAAGTCGGG - Intronic
1190656489 X:52617445-52617467 CAGGCAAATCACCTGAGGTCAGG + Intergenic
1190871229 X:54426281-54426303 CAGGCAAATCACCTGAGGTCAGG + Intergenic
1191214503 X:57921071-57921093 CAAACAAACCACCTGTGGCCAGG + Intergenic
1191219412 X:57971277-57971299 CAAGCAGATAACCTGAAGTCAGG - Intergenic
1191869491 X:65733879-65733901 CAGGCAAATCACCTGAGGTCAGG - Intronic
1192460687 X:71314529-71314551 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1192986682 X:76407175-76407197 CAAACAAAACAACTGTAGTCAGG - Intergenic
1193105833 X:77670660-77670682 CAAGTGAATCACCTGTACCCAGG + Intronic
1193377874 X:80783156-80783178 CAGGCAAATCACCTGAGGTCAGG + Intronic
1194713092 X:97259024-97259046 CAGGCAAATCACCTGAGGTCAGG + Intronic
1195048572 X:101077018-101077040 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1195216581 X:102710222-102710244 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1195551312 X:106174818-106174840 CAGGCAGATCACCTGAAGTCAGG + Intronic
1195569426 X:106382010-106382032 CAAACAAACTACCTGTAGCCAGG - Intergenic
1195633091 X:107080349-107080371 CAAGCAAATCACTTGAGGTCAGG + Intronic
1196741527 X:119029698-119029720 CAAGCACAGCACCGGTGGGCTGG - Intergenic
1196776517 X:119343029-119343051 CAAGCGGATCACCTGAAGTCGGG + Intergenic
1196861647 X:120034230-120034252 CAACCATATCAGCTGAAGGCAGG + Intergenic
1197193075 X:123670389-123670411 CAGGCAAATCACCTGAGGTCAGG + Intronic
1197210916 X:123827596-123827618 CAGGCAGATCACCTGAAGTCAGG - Intergenic
1197272314 X:124438153-124438175 CAAGCAGATCACCTGATGCCAGG - Intronic
1197771110 X:130090007-130090029 CAAGCAGATCACCTGAGGTCAGG + Intronic
1197784428 X:130186360-130186382 CAGGCAAATCACCTGAGGCCAGG - Intergenic
1197825941 X:130590373-130590395 CAAACAAAACTCCTGAAGGCAGG - Intergenic
1197930560 X:131690598-131690620 CAGGCAGATCACCTGAAGTCAGG + Intergenic
1198255330 X:134919364-134919386 CAAGCAGATCACCTGAGGTCAGG + Intergenic
1198327577 X:135589078-135589100 CAAGCGGATCACCTGAAGTCAGG + Intergenic
1198435471 X:136612780-136612802 CAGGCAGATCACCTGTGGTCAGG - Intergenic
1198637392 X:138714416-138714438 CAAGCAGATCACCTGAGGTCAGG + Intronic
1198689832 X:139268785-139268807 CAGGCAGATCACCTGTGGTCAGG - Intergenic
1198738917 X:139819956-139819978 CAGGCAGATCACCTGAAGTCAGG + Intronic
1198794308 X:140379270-140379292 CAAGCAGATCACCTGAGGTCAGG + Intergenic
1199079190 X:143557472-143557494 CAGGCAGATCACCTGAAGGCGGG + Intergenic
1199522347 X:148750195-148750217 CAGGCAAATCACCTGAGGTCAGG - Intronic
1200144039 X:153916848-153916870 CAAGCAGATCACCTGAAGTCAGG + Intronic
1200248100 X:154536605-154536627 CAGGCAGATCACCTGAAGTCAGG + Intronic
1200294091 X:154900459-154900481 CAAGCAGATCACCTGAGGTCAGG - Intronic
1200341793 X:155405063-155405085 CAAGCAAATCACTTGAGGCCAGG + Intergenic
1200404576 Y:2796873-2796895 CTAGCAGATCACCTGAAGTCAGG + Intergenic
1200613620 Y:5353229-5353251 CAGGCAGATCACCTGAAGTCAGG - Intronic
1200683434 Y:6239646-6239668 CCAGTAAATCACCTGAAGTCAGG + Intergenic
1201049200 Y:9914739-9914761 CCAGTAAATCACCTGAAGTCAGG - Intergenic
1201370879 Y:13262789-13262811 CAAGCAGATCACCTGAGGTCAGG - Intronic
1201730346 Y:17195411-17195433 CAAGGAAATCACTTGAAGCCAGG - Intergenic