ID: 1074538090

View in Genome Browser
Species Human (GRCh38)
Location 10:114343323-114343345
Sequence GTGATCACGAGGAAAGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 169}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074538090_1074538096 15 Left 1074538090 10:114343323-114343345 CCTCCTGCTTTCCTCGTGATCAC 0: 1
1: 0
2: 0
3: 13
4: 169
Right 1074538096 10:114343361-114343383 CATGAGCTCCCCGTCTGCATGGG No data
1074538090_1074538095 14 Left 1074538090 10:114343323-114343345 CCTCCTGCTTTCCTCGTGATCAC 0: 1
1: 0
2: 0
3: 13
4: 169
Right 1074538095 10:114343360-114343382 GCATGAGCTCCCCGTCTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074538090 Original CRISPR GTGATCACGAGGAAAGCAGG AGG (reversed) Intronic
902408569 1:16199789-16199811 GAGAAGACGAGGATAGCAGGGGG - Intronic
907205762 1:52769503-52769525 GAGAGCACTTGGAAAGCAGGTGG - Intronic
911943679 1:104077793-104077815 GGGATCACGAGGTCAGCAGATGG + Intergenic
913992797 1:143630386-143630408 GAGGTAAGGAGGAAAGCAGGTGG + Intergenic
915768761 1:158395663-158395685 GTGTTCCTGAGGAAAGCTGGTGG + Intergenic
916983269 1:170162947-170162969 CTCACCACGAGGCAAGCAGGAGG - Intronic
917534825 1:175866803-175866825 GTGAGCAGGAGAAAGGCAGGTGG + Intergenic
920603848 1:207359900-207359922 GGGATCACGAGGAAAAGAGAAGG + Exonic
922707090 1:227795502-227795524 GAGCTCACGAGGGAAGGAGGAGG - Intergenic
1065147124 10:22780855-22780877 TGGATCAAGAGGAAAGGAGGAGG + Intergenic
1069799282 10:71072240-71072262 GAGATCATGAGGACAGCAGCGGG + Intergenic
1071483958 10:86085655-86085677 CTGGTCACCAGGAAGGCAGGTGG + Intronic
1073777914 10:106806736-106806758 CTGATCACGAGGTCAGGAGGTGG - Intronic
1074538090 10:114343323-114343345 GTGATCACGAGGAAAGCAGGAGG - Intronic
1076303738 10:129448256-129448278 TTCATCATTAGGAAAGCAGGAGG - Intergenic
1077025112 11:436635-436657 GTGAGCAGGAGGTGAGCAGGGGG + Intronic
1077025122 11:436679-436701 GTGAGCAGGAGGTGAGCAGGGGG + Intronic
1077025126 11:436690-436712 GTGAGCAGGGGGTAAGCAGGGGG + Intronic
1077025146 11:436745-436767 GTGAGCAGGGGGTAAGCAGGGGG + Intronic
1077025185 11:436877-436899 GTGAGCAGGGGGTAAGCAGGAGG + Intronic
1077025200 11:436921-436943 GTGAGCAGGAGGTGAGCAGGGGG + Intronic
1077274805 11:1699611-1699633 GTGAGCACGTGGGATGCAGGAGG - Intergenic
1077444866 11:2586240-2586262 GAGCTCACGAGGACTGCAGGGGG - Intronic
1082008294 11:47433387-47433409 GTGAGCAGGAGGGAAGGAGGAGG - Intergenic
1084424273 11:69076256-69076278 GTGGTCACTGGGTAAGCAGGAGG + Intronic
1086918466 11:92558136-92558158 GTGATCCCCAGGAGAGCAGAGGG + Intronic
1087670460 11:101100189-101100211 ATGATCACGAGAAGAGCATGGGG - Intronic
1088914548 11:114217667-114217689 GTGACCACCAGGAAGCCAGGAGG - Intronic
1090488869 11:127140218-127140240 GTGAATAGCAGGAAAGCAGGAGG - Intergenic
1098546673 12:71719157-71719179 GTGATCCCAGGGAAAGCAGGTGG - Intergenic
1100090227 12:90958879-90958901 GTGAACACCAGGAGACCAGGAGG + Intergenic
1100444792 12:94650484-94650506 GTGATCCCGAGCACAGCCGGTGG - Exonic
1103163355 12:118749597-118749619 GTGATGAGGAGGAGAGGAGGTGG - Intergenic
1105692097 13:22851511-22851533 CAGATCACGAGGACAGCAGATGG + Intergenic
1111236338 13:85413535-85413557 GTGATGATGAGGTGAGCAGGAGG + Intergenic
1112314640 13:98350646-98350668 GTGCTCACGAGGAGAGAGGGAGG - Intronic
1113783583 13:112990066-112990088 GTGAACAGGGGGTAAGCAGGAGG - Intronic
1117120492 14:52563275-52563297 GTGATCACTTGGAAAGAAGAGGG - Intronic
1117322377 14:54636303-54636325 GTGATCAAGAGGAAGGGTGGTGG + Intronic
1119336838 14:73840436-73840458 GAGGCCACGAGGAAAGCAGCAGG + Intergenic
1121795398 14:96730615-96730637 ATGATCACCAGGCAAGCAAGGGG + Intergenic
1128369578 15:67030556-67030578 GTGATCACCAGAAAAGAAAGGGG - Intergenic
1128933392 15:71725544-71725566 GAGAGCAGGAGGAAAGCAAGGGG + Intronic
1129893130 15:79085044-79085066 GTAAGCACCAGGAGAGCAGGAGG - Intronic
1130491300 15:84433452-84433474 GTGAACATGAGGAGAGCAGGAGG - Intergenic
1130863107 15:87908652-87908674 AGGAGCATGAGGAAAGCAGGGGG + Intronic
1131529421 15:93179296-93179318 GTAACCACGAGGAAAGCATCAGG - Intergenic
1131749940 15:95495428-95495450 GAGAGCTGGAGGAAAGCAGGAGG + Intergenic
1132949013 16:2549938-2549960 GTGTTCACCAGGGAACCAGGAGG - Intronic
1132965575 16:2652189-2652211 GTGTTCACCAGGGAACCAGGAGG + Intergenic
1133781398 16:8941863-8941885 GTGAGCACCAGGAGACCAGGAGG - Intronic
1135586036 16:23671768-23671790 GAGTGCACAAGGAAAGCAGGTGG - Exonic
1137396960 16:48123018-48123040 GTGGTCACTGGGGAAGCAGGGGG - Intronic
1137753816 16:50886057-50886079 ATGTACACGAGCAAAGCAGGTGG - Intergenic
1137941665 16:52694230-52694252 ATGATGCCGAGGAAGGCAGGAGG - Intergenic
1142414335 16:89933368-89933390 GTGAGCAGGAGGATGGCAGGCGG + Intronic
1142604431 17:1073762-1073784 GTGTTCACGTGGGAAGCATGCGG - Intronic
1145296686 17:21598480-21598502 CTGATCACCAGGAATGCAGTTGG - Intergenic
1146803575 17:35847007-35847029 GAGGCCACGAGGAAAGCAGCAGG - Exonic
1147251172 17:39153126-39153148 TTGACCTCGAGGAAGGCAGGAGG - Intronic
1147273111 17:39291182-39291204 GTGATCACGAGGTCAGGAGATGG - Intronic
1150323171 17:64233623-64233645 GGAATCACGAGGAATTCAGGTGG + Intronic
1150853880 17:68732159-68732181 GTTATCAGGAGCAAAGCAGATGG + Intergenic
1152373604 17:79906025-79906047 GTCAAAACGAGGAAGGCAGGTGG - Intergenic
1157397576 18:47355656-47355678 TTGAGCACTAGGAAAACAGGGGG + Intergenic
1157986380 18:52442877-52442899 GGGATCAGGGGTAAAGCAGGTGG + Intronic
1158349577 18:56551330-56551352 ATGATAAAGAGAAAAGCAGGTGG - Intergenic
1164250055 19:23468302-23468324 GGGAGGACGAGGAAAGGAGGAGG - Intergenic
1164449549 19:28348623-28348645 CTCATCCAGAGGAAAGCAGGTGG + Intergenic
1165434294 19:35787990-35788012 GTGGTCAGGGGGAAAGCAGGAGG - Exonic
1168509703 19:56964659-56964681 GTGATGGCCAGGAAAGCAGGAGG + Intergenic
925290643 2:2746133-2746155 ATGATCACGAGAACAGCAAGGGG + Intergenic
928243333 2:29605614-29605636 GTGATCACCTGGCAAGAAGGTGG + Intronic
928785306 2:34877462-34877484 GTGAGTACTAGGAAAGGAGGGGG + Intergenic
933314874 2:80704031-80704053 GTAATCACTAGGAAACCAGAGGG - Intergenic
933830436 2:86203306-86203328 CAGATCACGAGGAGATCAGGAGG - Intronic
933901865 2:86855922-86855944 GTGCTCAGGAGGAATCCAGGGGG - Intronic
934646930 2:96064248-96064270 GAGAGCAGGAGGAGAGCAGGAGG + Intergenic
934946151 2:98543416-98543438 GAGATGACGAGGCAAGCAGGAGG + Intronic
936694212 2:114927887-114927909 GAGATCACAAGGCAAGTAGGGGG + Intronic
937427876 2:121814946-121814968 GTGATCACGAGGTCAGGAGGTGG - Intergenic
939995645 2:148916736-148916758 TTGATTGGGAGGAAAGCAGGGGG + Intronic
944529287 2:200651513-200651535 CTGCTCATGTGGAAAGCAGGAGG + Intronic
946000401 2:216477348-216477370 ATGGTCATGATGAAAGCAGGAGG - Intronic
947450645 2:230205309-230205331 GTGATGATGAAGAAAGAAGGTGG - Intronic
948701762 2:239765085-239765107 GTGAGCAAGAGGACACCAGGAGG - Intronic
1169063340 20:2677515-2677537 CTGATCAGGATGAAAACAGGTGG + Intergenic
1169475907 20:5930976-5930998 CTGCTCACGAGGAAAGCTGCTGG + Intergenic
1170965768 20:21069713-21069735 GCTATCACGAGAATAGCAGGGGG + Intergenic
1172454938 20:35063085-35063107 GTTATCACGAGAACAGCATGGGG - Intronic
1172607015 20:36220821-36220843 GTGGCCAGGAGGAAGGCAGGAGG + Intronic
1172862224 20:38063501-38063523 GGGCTCAGGAGGAGAGCAGGTGG + Intronic
1173690316 20:44955781-44955803 GTGATAGCCAGGAGAGCAGGAGG - Intronic
1173896960 20:46558596-46558618 GTGCTCACTTGGAAAGGAGGTGG + Exonic
1174096003 20:48089941-48089963 GTGAGCACGAGGAGTGAAGGGGG - Intergenic
1178364105 21:31974122-31974144 GTGATCATAAGGAAATCTGGGGG + Intronic
1179339043 21:40487009-40487031 GGGAGCACCAGGTAAGCAGGTGG + Intronic
1180237552 21:46472823-46472845 GTGACCAAGAGTAAGGCAGGAGG + Intronic
1180738043 22:18033456-18033478 GTGATCTCAAGCAAAGCTGGAGG + Intergenic
1181308263 22:21929204-21929226 GTGATCAGGATCACAGCAGGAGG + Intronic
1182827996 22:33282453-33282475 GTGATCCAGGGGAAAGTAGGTGG - Intronic
1183309113 22:37099826-37099848 GTGAGCAACAGGACAGCAGGAGG + Intronic
1183684194 22:39351935-39351957 GAGAGGACGTGGAAAGCAGGAGG + Intronic
949318243 3:2780984-2781006 GGGAACTCTAGGAAAGCAGGAGG + Intronic
950195349 3:11005610-11005632 GTGATGAGGAGGAAAACAGGAGG - Intronic
962424931 3:135261461-135261483 GTGCACAAGAGGAAAGCATGAGG + Intergenic
964820278 3:160761286-160761308 ATGATGGAGAGGAAAGCAGGAGG - Intronic
968125996 3:196160693-196160715 GTGATCAGGAGTAAATCAGCTGG + Intergenic
968762861 4:2451373-2451395 GTGATGCCGTGGAAGGCAGGTGG - Intronic
969913710 4:10468845-10468867 GTGTTCTCTAGGAAAGAAGGAGG + Intergenic
972673987 4:41241529-41241551 GGGATCAAGAGGCAGGCAGGAGG - Intergenic
973662242 4:53119974-53119996 GTCATAACCAGGAAAGCAAGGGG + Intronic
979174151 4:117641116-117641138 TTGTTCAGGAGGAAAGCAGAAGG - Intergenic
984954672 4:185033516-185033538 GGGATCGGGAGGAGAGCAGGTGG - Intergenic
986279900 5:6314428-6314450 GAGCTCAGGGGGAAAGCAGGGGG - Intergenic
987212209 5:15694325-15694347 GTTATAACTAGCAAAGCAGGTGG + Intronic
988445847 5:31284912-31284934 TGGATCAGGAGCAAAGCAGGAGG + Intronic
989124501 5:38038479-38038501 GTGATCCCGTGGAAAGCAGTGGG + Intergenic
989131428 5:38111058-38111080 GTGATCACGTGGATGGCAGGGGG - Intergenic
989248722 5:39282731-39282753 CTTATCACAAGGAAAGCATGGGG + Intergenic
990631086 5:57669970-57669992 ATGATCACGAGAACAGCATGGGG + Intergenic
991422013 5:66451747-66451769 GTGATCTGGAGGAAAGAAAGAGG + Intergenic
993809985 5:92464162-92464184 GAGATCTAGAGGAAAGGAGGAGG + Intergenic
993867212 5:93209796-93209818 TTGACCAGCAGGAAAGCAGGGGG - Intergenic
997796354 5:136815336-136815358 GTGAGCAGGAGGGAAGCATGGGG - Intergenic
998521901 5:142808607-142808629 GTGATAACAAGGAAAGCAGCTGG - Intronic
999764294 5:154726928-154726950 GTTATCACGAGAACAGCATGGGG + Intronic
1003040325 6:2682017-2682039 TTGAGCAGGAGGAGAGCAGGAGG - Intronic
1004811211 6:19265840-19265862 GTGAGAAAGAGGTAAGCAGGAGG + Intergenic
1007881695 6:45175420-45175442 GGGATCACGAGAACAGCATGGGG + Intronic
1011857518 6:91713199-91713221 GTCATCACGTGGAAGGCAGGGGG - Intergenic
1012164799 6:95935499-95935521 GTGTTCACAAAGAAAGCTGGAGG + Intergenic
1013856122 6:114574434-114574456 CTGCTCACGAGGAAACCAGCTGG - Intergenic
1017537544 6:155364217-155364239 GAGACCACGAGCACAGCAGGAGG + Intergenic
1019127039 6:169847456-169847478 ATGATCACGAGAACAGCAAGGGG - Intergenic
1019417975 7:935851-935873 GCGGACACGAGGAAAGCAGGTGG - Intronic
1020261735 7:6534497-6534519 GTGGTCACCATGTAAGCAGGTGG - Intronic
1021482720 7:21135604-21135626 GTGAGCACCAGGAATGAAGGCGG + Intergenic
1024562980 7:50660170-50660192 GTGTTCACGTGGGAAGTAGGGGG + Intronic
1026062865 7:67041638-67041660 ATGATCACGCGGAAAGCATTCGG - Intronic
1026614291 7:71887807-71887829 GTGAGAAGGAGGAGAGCAGGTGG + Intronic
1027786931 7:82591873-82591895 GGGATCAAGAGGAAAACAGTTGG - Intergenic
1029996560 7:105013322-105013344 GTGATCTCGAAGAAAAAAGGGGG - Intergenic
1031194746 7:118599215-118599237 GCTATCACGAGGACAGCATGGGG - Intergenic
1031725604 7:125234223-125234245 GTGATCTCATGGGAAGCAGGAGG - Intergenic
1031839181 7:126716810-126716832 GTGATTGAGAGGAAAGCATGAGG + Intronic
1034263321 7:149770379-149770401 GAGGGCAGGAGGAAAGCAGGGGG + Intronic
1035254592 7:157618268-157618290 GTGAGCACGCGGAAAGGACGCGG + Exonic
1035336217 7:158128707-158128729 GTGTTCACCCGGAGAGCAGGAGG - Intronic
1035565438 8:637709-637731 GGGAGCAGGAGGAAAGCTGGGGG + Intronic
1035848592 8:2891419-2891441 GAAATCCAGAGGAAAGCAGGGGG + Intergenic
1037520274 8:19674350-19674372 GGGATCAAGAGGAATGGAGGTGG + Intronic
1038733247 8:30146378-30146400 ATGATCACGAGAACAGCATGGGG + Intronic
1038829008 8:31035897-31035919 GTGATTGCTAGGAAAGCGGGTGG - Intronic
1039275056 8:35926193-35926215 GTGATCAGGATGAAAGGAGTAGG + Intergenic
1039803062 8:40976301-40976323 GTGACCCCGAGGGGAGCAGGAGG - Intergenic
1040298877 8:46177708-46177730 GGGATCTCGAGGCAAGCAGAGGG + Intergenic
1040619417 8:49073001-49073023 GTGACAATGAAGAAAGCAGGAGG + Intronic
1045478523 8:102574378-102574400 GGGGTCACGAGGAATGCAGGTGG + Intergenic
1046716138 8:117569559-117569581 GTGTTAACAAGGATAGCAGGTGG + Intergenic
1049573506 8:143380261-143380283 GTCAGCACGGGGACAGCAGGTGG - Intronic
1050223738 9:3426511-3426533 GTGAGCAAGAGGTGAGCAGGAGG + Intronic
1050231138 9:3526601-3526623 GTGAGAGCGCGGAAAGCAGGAGG - Intergenic
1050396671 9:5205170-5205192 GTGATCAAGAGGAAAGTGGAGGG - Intergenic
1052479273 9:29001924-29001946 GTGATGAAGAGAGAAGCAGGTGG - Intergenic
1052643085 9:31194370-31194392 ATGATCACGAGAACAGCATGGGG + Intergenic
1056233343 9:84568968-84568990 GTGACCACAATGGAAGCAGGAGG + Intergenic
1056778526 9:89532075-89532097 CTCATCACACGGAAAGCAGGTGG - Intergenic
1057194636 9:93110297-93110319 GTGGTCACAAAGAAAGCATGGGG - Intronic
1058777699 9:108301139-108301161 GTGACCAGGAGGAAATCATGAGG + Intergenic
1060248341 9:121965458-121965480 GTTATCACGAGAACAGCATGGGG + Intronic
1060273931 9:122167942-122167964 GAGATGACGATGAAAGCAGAGGG - Intronic
1060606448 9:124918853-124918875 AGGATCAGGAGGACAGCAGGAGG - Intronic
1060695256 9:125704037-125704059 GGGATCACGAGGAATGGAAGTGG - Intronic
1185432716 X:18906-18928 GTGATCCCGAGGGAAGGAGCGGG - Intergenic
1185442067 X:231728-231750 GTGATCCCGAGGGAAGGAGCGGG - Intergenic
1188342424 X:29020645-29020667 GGGATGACTAGGAAAGTAGGAGG + Intronic
1195368629 X:104151145-104151167 GTGATAAGGAGGAAACCTGGGGG - Intronic
1196611526 X:117720072-117720094 ATTATCACGAGAAAAGCATGGGG - Intergenic
1199076688 X:143533820-143533842 TTAATTACGAGGGAAGCAGGAGG + Intergenic
1201629211 Y:16050812-16050834 TTGATGAAGAGAAAAGCAGGTGG + Intergenic
1201928412 Y:19315102-19315124 ATGATGAGGAGGAAAGGAGGAGG - Intergenic
1202068184 Y:20962318-20962340 ATGATCAAGAGGTAAGCAGTGGG + Intergenic