ID: 1074538456

View in Genome Browser
Species Human (GRCh38)
Location 10:114345607-114345629
Sequence ATCAGGGATGTGGCCAAATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 155}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074538456_1074538461 -8 Left 1074538456 10:114345607-114345629 CCCAATTTGGCCACATCCCTGAT 0: 1
1: 0
2: 2
3: 9
4: 155
Right 1074538461 10:114345622-114345644 TCCCTGATGAGTAGCGGCACGGG No data
1074538456_1074538460 -9 Left 1074538456 10:114345607-114345629 CCCAATTTGGCCACATCCCTGAT 0: 1
1: 0
2: 2
3: 9
4: 155
Right 1074538460 10:114345621-114345643 ATCCCTGATGAGTAGCGGCACGG No data
1074538456_1074538465 -6 Left 1074538456 10:114345607-114345629 CCCAATTTGGCCACATCCCTGAT 0: 1
1: 0
2: 2
3: 9
4: 155
Right 1074538465 10:114345624-114345646 CCTGATGAGTAGCGGCACGGGGG No data
1074538456_1074538463 -7 Left 1074538456 10:114345607-114345629 CCCAATTTGGCCACATCCCTGAT 0: 1
1: 0
2: 2
3: 9
4: 155
Right 1074538463 10:114345623-114345645 CCCTGATGAGTAGCGGCACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074538456 Original CRISPR ATCAGGGATGTGGCCAAATT GGG (reversed) Intronic
902544350 1:17179012-17179034 ACCAAGGATGTGGTCAATTTTGG - Intergenic
905044648 1:34986027-34986049 ATCAGACATCTGGCCAAATTTGG - Intronic
910510819 1:88002043-88002065 ATCAAGGATGAATCCAAATTTGG + Intergenic
911070151 1:93825871-93825893 AGCTGGCATGTGGGCAAATTAGG - Intronic
912655917 1:111486277-111486299 AGCAGGGATGTGGCCACCCTTGG - Intronic
912836124 1:112998034-112998056 AGCAGGGAGATGGCCAAAATAGG - Intergenic
914356482 1:146889250-146889272 AGCAAGGATGTGGAGAAATTGGG + Intergenic
914454022 1:147818703-147818725 TTCTGGGTTGGGGCCAAATTTGG - Intergenic
916068818 1:161158164-161158186 GCCAGGAATGTGCCCAAATTTGG + Exonic
916371652 1:164102917-164102939 ATTAGGAGTGTGGGCAAATTGGG + Intergenic
916464094 1:165056317-165056339 GTCAGGAATGTGGAAAAATTTGG - Intergenic
916551410 1:165853215-165853237 ATCAGAGATGGGGGAAAATTTGG + Intronic
917403341 1:174677029-174677051 ATCAGGGAAGTGGCCAGATGGGG + Intronic
917975827 1:180237010-180237032 AACAGAGATGTGGGCAAATAGGG + Intronic
918521619 1:185420931-185420953 ATAAGGGATGTGGTGCAATTGGG + Intergenic
921992453 1:221382156-221382178 ATCAGGGATTTTGCCAAACAAGG - Intergenic
922634407 1:227151600-227151622 GTCAAGGATGTGAACAAATTAGG - Intronic
924024512 1:239818326-239818348 ATCCCTCATGTGGCCAAATTTGG - Intronic
924363048 1:243261092-243261114 ATGAGGCTTATGGCCAAATTGGG + Intronic
924910314 1:248504403-248504425 GTCAGGGAAGTAGACAAATTGGG - Intergenic
924913786 1:248543636-248543658 GTCAGGGAAGTAGACAAATTGGG + Intergenic
1065071581 10:22030471-22030493 AACAGGGATGGAGCCAGATTTGG + Intergenic
1069617030 10:69812957-69812979 ATCAGAGCTGTGGCCAAAAGGGG - Intronic
1071067607 10:81655271-81655293 ATCAGAAAAGTTGCCAAATTTGG - Intergenic
1074538456 10:114345607-114345629 ATCAGGGATGTGGCCAAATTGGG - Intronic
1080701644 11:34649405-34649427 GTCAGGGGAGTGGCCAAGTTTGG + Intronic
1081066977 11:38555085-38555107 AACAGGCTTGTGGCCAATTTTGG + Intergenic
1084009371 11:66339072-66339094 ATCAGGGAAGGGGCCAGGTTAGG - Intronic
1084527493 11:69705860-69705882 ATCAGGGAGGTGGGGAAATGAGG + Intergenic
1084627487 11:70319584-70319606 ATAAGGGATGTGCTCAAAATGGG - Intronic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1092673259 12:10886845-10886867 ATCAGGCAAGTGGTCATATTTGG - Intronic
1094323095 12:29206823-29206845 ATCAGGGATGAAGTCAGATTTGG + Intronic
1094467303 12:30766864-30766886 ATCAGGGTATTGGCCAAAGTAGG - Intergenic
1098608684 12:72427156-72427178 TGAATGGATGTGGCCAAATTTGG + Intronic
1100377736 12:94032895-94032917 ATTAGGGATGTTGTCAAGTTAGG - Intergenic
1103044050 12:117720456-117720478 TTTAGGCATGGGGCCAAATTAGG - Intronic
1104494838 12:129227175-129227197 CTCAAGCATGTGGCCAAATATGG + Intronic
1105613185 13:21986941-21986963 ATCAGGGAGGTGTTCAAGTTAGG - Intergenic
1105717329 13:23080561-23080583 ATCATGGATGTGTACACATTAGG + Intergenic
1107295747 13:38905493-38905515 ATCAAGGATGTGGACACATAAGG - Intergenic
1110810580 13:79807578-79807600 AGCAGGGTTGGGGCCGAATTCGG + Intergenic
1111688503 13:91530848-91530870 ATTAAGAATATGGCCAAATTGGG - Intronic
1118925297 14:70186379-70186401 AGCAGGGATGTGGCCTAGTCAGG + Intronic
1125098156 15:35878466-35878488 ATCAGGGAAGGAGCCAAATCAGG - Intergenic
1125745923 15:41997094-41997116 ATCAGGGATGTGGCCAGCCTGGG - Intronic
1126467612 15:48975292-48975314 ATAAGGATTGTGGCTAAATTAGG - Intergenic
1126651926 15:50931807-50931829 ACCAGGCATTTGGCCAGATTAGG + Intronic
1128635567 15:69299900-69299922 ATCAGGGATGTGTCCCTTTTTGG - Intronic
1129654063 15:77511024-77511046 AGCAGGGAGGTGGCCAAGTGAGG + Intergenic
1129787772 15:78320800-78320822 ATCAGGGATGTTTCCAGAGTTGG + Intergenic
1133423394 16:5666147-5666169 ATGATGGATGTGCCCAAATGTGG - Intergenic
1136366845 16:29812908-29812930 GACAGGAATGTGGCCCAATTGGG + Intronic
1137764270 16:50965914-50965936 ATCAAAGCTGTGGCCACATTGGG + Intergenic
1139977535 16:70826203-70826225 AGCAAGGATGTGGAGAAATTGGG - Intronic
1157070705 18:44404752-44404774 GTTATGGGTGTGGCCAAATTTGG + Intergenic
1158473318 18:57758147-57758169 ATCAAGGATGGGGCCAGACTTGG - Intronic
1158895254 18:61906763-61906785 GGCAGGGATGTGGAGAAATTAGG - Intergenic
1161570585 19:5028709-5028731 GGCAGGGATGTGGAGAAATTGGG - Intronic
1165659754 19:37566935-37566957 ATCAGAAAAGTGGCCAAAGTGGG - Intronic
1166132917 19:40757362-40757384 ATCCAGGATCTGGCCAAACTGGG - Exonic
1168531512 19:57133487-57133509 ATAAGGAATGGGGCAAAATTAGG + Intergenic
925404771 2:3598901-3598923 ATCAGATATGTGTCCACATTTGG + Intronic
926776808 2:16431222-16431244 ATCTGGGATGTAGCCACAGTGGG + Intergenic
930798226 2:55415355-55415377 TTCAGGGAGGAGGGCAAATTTGG - Intronic
933010831 2:77061053-77061075 ATCAAGGAAGTGGCAAAACTAGG - Intronic
934766968 2:96885131-96885153 AGCAGGGATGAGGCCCATTTAGG + Intronic
935901528 2:107798525-107798547 TTCAGGGATGTGTACAAATAAGG + Intergenic
936108417 2:109645359-109645381 ATCAGGGATTTGGCCAGAAGGGG - Intergenic
937113101 2:119382727-119382749 GTCAGGGCTGTGCCCATATTAGG + Intergenic
938231027 2:129659195-129659217 ATGAGGGGGGTGGCCAAATTTGG + Intergenic
939804864 2:146762497-146762519 ATCAAGGATGTGACAAGATTTGG + Intergenic
940067819 2:149649436-149649458 AGCAGGGATGTTGCCAGAGTGGG + Intergenic
942780703 2:179638745-179638767 ACCAGGGATGGGACCAAGTTAGG + Intronic
943801927 2:192071059-192071081 GTAAGGGAGGAGGCCAAATTAGG + Intronic
944486989 2:200217338-200217360 ATCAAGCATGTGGCCAACTCAGG - Intergenic
944852632 2:203735536-203735558 ATGAGGGATTTGGTCAAATGAGG + Exonic
945023410 2:205596720-205596742 ATCATGTTTGTGGCCAAATAGGG + Intronic
945696196 2:213107963-213107985 ATCAGGCATGATGCTAAATTAGG + Intronic
948070339 2:235116280-235116302 ATGAGAGATGTGGCCAGATGAGG - Intergenic
1170187605 20:13608721-13608743 ACCAGGCATCTGGCCAGATTTGG + Intronic
1175081259 20:56422285-56422307 ATCATGGATGTGGCCCAAGATGG - Intronic
1175557481 20:59878322-59878344 ATCAGAGATGTGGTACAATTGGG - Intronic
1179712510 21:43271540-43271562 ATCAGCGATGCTTCCAAATTTGG + Intergenic
1182510620 22:30817414-30817436 TTGAGGGCTGTGGCCAACTTGGG + Intronic
1184798073 22:46743240-46743262 ATGAGGGATGGGGCCACATTTGG + Intergenic
1184817574 22:46883963-46883985 CTCAGGGCTGTGGCCACCTTTGG + Intronic
949141243 3:635857-635879 ATAATGGAGGTGGACAAATTTGG + Intergenic
949458211 3:4262039-4262061 ATCAGAGATGTGGTCAGTTTTGG - Intronic
950014270 3:9744829-9744851 AGCAGGGCTGTGGCCAACTGTGG + Intronic
950193038 3:10991574-10991596 AGCAGGGAGGAGGCCAGATTAGG + Intergenic
951035243 3:17925555-17925577 AACAGGGAGGAGGCAAAATTTGG + Intronic
952875062 3:37937788-37937810 AGCAGGGATGTTGCTAAATTTGG + Intronic
953664278 3:44914931-44914953 GCCAGGGATGTGGGCAACTTGGG - Exonic
955264768 3:57431543-57431565 ATCAGGGATGTGAAAATATTGGG - Intronic
955673294 3:61424829-61424851 ATGGGGGATGTGGCCATCTTTGG - Intergenic
957023472 3:75151596-75151618 CTCAGGCATCTAGCCAAATTTGG + Intergenic
957884788 3:86272265-86272287 ATTAGTGATGAGGCCAAATCAGG + Intergenic
959231858 3:103664873-103664895 ACCAGAGATGAGGGCAAATTGGG - Intergenic
959360530 3:105384942-105384964 ATCACTGATATGGCCCAATTAGG - Intronic
961581900 3:127890081-127890103 ATCAGTGCTGTGGCCACATATGG + Intergenic
962413728 3:135163789-135163811 TTCTGGTAAGTGGCCAAATTTGG + Intronic
963718133 3:148827942-148827964 ATGAGTAATGTGTCCAAATTTGG - Intronic
965984206 3:174732034-174732056 AACAGGCATCCGGCCAAATTTGG + Intronic
974021894 4:56698915-56698937 AGCAGGGATGGGGCCAAATTGGG - Intergenic
975164566 4:71163715-71163737 ATAATGGATGTGACCAGATTTGG - Intergenic
977563748 4:98560976-98560998 ATGAGGTATGTGGCCGAGTTTGG + Intronic
978865238 4:113499812-113499834 AACAGTGATGTGGCCAAAGGAGG + Intronic
980498706 4:133619573-133619595 ACCAGGAATGTGGCCATATGTGG - Intergenic
981900488 4:149856234-149856256 AGCAGGGATGTGGCATGATTGGG - Intergenic
981901042 4:149863881-149863903 ATCAGTGATGTGGCAAAAAATGG + Intergenic
983217657 4:165017073-165017095 ATCAGTCATGTGGCACAATTGGG - Intergenic
985282401 4:188300441-188300463 AGGAGGGATGGGGGCAAATTGGG - Intergenic
985874136 5:2582452-2582474 AACAGGGATGTGATCAGATTTGG + Intergenic
986979877 5:13435143-13435165 ATCAAGGATCTGGCCAACTGCGG - Intergenic
987692697 5:21287883-21287905 AGCAGGTATGTGTCCACATTGGG + Intergenic
989668579 5:43887307-43887329 ATCACAGATGGGGCCAAACTTGG - Intergenic
990633308 5:57694944-57694966 ATCTGGGATGTAGCCTGATTAGG + Intergenic
991245080 5:64502200-64502222 ATCAGGCATGTGCCAAAATCGGG + Intergenic
991747658 5:69762164-69762186 AGCAGGTATGTGTCCACATTGGG - Intergenic
991750071 5:69793160-69793182 AGCAGGTATGTGTCCACATTGGG + Intergenic
991799236 5:70342018-70342040 AGCAGGTATGTGTCCACATTGGG - Intergenic
991801644 5:70372965-70372987 AGCAGGTATGTGTCCACATTGGG + Intergenic
991826952 5:70637061-70637083 AGCAGGTATGTGTCCACATTGGG - Intergenic
991829361 5:70668018-70668040 AGCAGGTATGTGTCCACATTGGG + Intergenic
991891595 5:71341445-71341467 AGCAGGTATGTGTCCACATTGGG - Intergenic
1000917928 5:167104442-167104464 ATCAGGAATGAGGGCAAATATGG + Intergenic
1004350500 6:14886397-14886419 AGCTGGGATGTGGAAAAATTTGG - Intergenic
1007015125 6:38458056-38458078 ATCATGGATATGGCAAAATCTGG - Intronic
1009974424 6:70657893-70657915 ACTAGGCATGTGACCAAATTAGG - Intergenic
1012500056 6:99878649-99878671 TTCAGTGCTGTGGCCAGATTAGG + Intergenic
1016411984 6:143792991-143793013 ATCACAATTGTGGCCAAATTTGG + Intronic
1017012604 6:150072561-150072583 AGCAGGGGTGTGGGCAAATATGG + Intergenic
1017045523 6:150344067-150344089 ACCAGGGCTGTGGCCAACCTGGG - Intergenic
1017110453 6:150927745-150927767 ATCTGGGATGTGGCCAGGTGCGG - Intronic
1017767743 6:157620682-157620704 AGCAGGAATGTGGCCACAATGGG - Intronic
1021862446 7:24920015-24920037 ATCAAGGATGTGGAGAAACTGGG + Intronic
1021916715 7:25441257-25441279 CTCTGGGATGTGGCTAAATCAGG - Intergenic
1023598192 7:41854472-41854494 GTCAGGCATGTGGCCATCTTGGG - Intergenic
1024189322 7:46989411-46989433 GAGTGGGATGTGGCCAAATTGGG + Intergenic
1024237946 7:47412280-47412302 CTCAGGAATGTGTACAAATTTGG + Intronic
1030597898 7:111561906-111561928 TTTAGGGTTTTGGCCAAATTGGG - Exonic
1032586168 7:133148896-133148918 ATCATGTATGTGGGGAAATTTGG - Intergenic
1033531160 7:142265376-142265398 ACCAGAGAGGTGGACAAATTAGG - Intergenic
1035166243 7:156991923-156991945 ATCAGGGATTTGGCCAAGGCTGG - Intergenic
1038417956 8:27411365-27411387 TTCAGGGGGGTGGCCAGATTGGG - Intronic
1043118380 8:76288917-76288939 CTCGGGGATGGGGACAAATTGGG + Intergenic
1043476790 8:80613121-80613143 ATATGGGATGTGGCCAAATTTGG - Intergenic
1044051523 8:87511710-87511732 TACAGGGATAGGGCCAAATTAGG + Intronic
1044899488 8:96928689-96928711 ATCAGTGATGTGGAGAAATCTGG - Intronic
1047861506 8:128972243-128972265 ATAAGGGACTTGGCCAAACTTGG + Intergenic
1048935035 8:139347964-139347986 ATCAGGGATGAGGTCATATTGGG + Intergenic
1050652461 9:7789199-7789221 ATCAGGGTTGTGGCAGAACTTGG + Intergenic
1051324599 9:15951350-15951372 ACCAGGTATGTGGTCAATTTTGG - Intronic
1052996328 9:34553328-34553350 CTAAGGGATGGGGCCAAATTTGG - Intronic
1057888080 9:98846220-98846242 ATCAGGGATGTGGCCATGCATGG + Intronic
1058630229 9:106979005-106979027 ATCAAGGAGATGGCCAAATTGGG - Intronic
1059514224 9:114877993-114878015 ATCATTGAAGTGGACAAATTAGG - Intergenic
1062217191 9:135395626-135395648 CCCAGGGCTCTGGCCAAATTAGG - Intergenic
1190060091 X:47205246-47205268 AGGAGGGACGTGGCCCAATTTGG + Intronic
1190725823 X:53190000-53190022 CTGAGGGATGTGGCAACATTTGG + Intergenic
1195307798 X:103602940-103602962 ATCAGGGAGGTGGTCAGATGTGG - Intergenic
1199527904 X:148812601-148812623 ATCAGGGAGGTGGGAAAGTTGGG - Intronic
1201793352 Y:17866573-17866595 AGCAGTGATGTGGTCAAAATGGG - Intergenic
1201808202 Y:18039413-18039435 AGCAGTGATGTGGTCAAAATGGG + Intergenic
1202354739 Y:24034402-24034424 AGCAGTGATGTGGTCAAAATGGG - Intergenic
1202516039 Y:25635707-25635729 AGCAGTGATGTGGTCAAAATGGG + Intergenic