ID: 1074544702

View in Genome Browser
Species Human (GRCh38)
Location 10:114393579-114393601
Sequence CTGGGGACAGGGAGGGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074544690_1074544702 13 Left 1074544690 10:114393543-114393565 CCGAAGCCTCTTTCATCGTGAGT 0: 1
1: 0
2: 0
3: 4
4: 94
Right 1074544702 10:114393579-114393601 CTGGGGACAGGGAGGGAAGTTGG No data
1074544689_1074544702 14 Left 1074544689 10:114393542-114393564 CCCGAAGCCTCTTTCATCGTGAG 0: 1
1: 0
2: 1
3: 10
4: 85
Right 1074544702 10:114393579-114393601 CTGGGGACAGGGAGGGAAGTTGG No data
1074544691_1074544702 7 Left 1074544691 10:114393549-114393571 CCTCTTTCATCGTGAGTAGAGAC 0: 1
1: 0
2: 0
3: 5
4: 55
Right 1074544702 10:114393579-114393601 CTGGGGACAGGGAGGGAAGTTGG No data
1074544688_1074544702 15 Left 1074544688 10:114393541-114393563 CCCCGAAGCCTCTTTCATCGTGA 0: 1
1: 0
2: 0
3: 7
4: 49
Right 1074544702 10:114393579-114393601 CTGGGGACAGGGAGGGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074544702 Original CRISPR CTGGGGACAGGGAGGGAAGT TGG Intronic
No off target data available for this crispr