ID: 1074549125

View in Genome Browser
Species Human (GRCh38)
Location 10:114426947-114426969
Sequence ATCTGAGAAGGGCAAACCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074549125_1074549128 19 Left 1074549125 10:114426947-114426969 CCTTGGGTTTGCCCTTCTCAGAT No data
Right 1074549128 10:114426989-114427011 AGAGTATTTAGCCCAGCACCTGG No data
1074549125_1074549129 26 Left 1074549125 10:114426947-114426969 CCTTGGGTTTGCCCTTCTCAGAT No data
Right 1074549129 10:114426996-114427018 TTAGCCCAGCACCTGGCACTTGG No data
1074549125_1074549130 29 Left 1074549125 10:114426947-114426969 CCTTGGGTTTGCCCTTCTCAGAT No data
Right 1074549130 10:114426999-114427021 GCCCAGCACCTGGCACTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074549125 Original CRISPR ATCTGAGAAGGGCAAACCCA AGG (reversed) Intergenic
No off target data available for this crispr