ID: 1074549128

View in Genome Browser
Species Human (GRCh38)
Location 10:114426989-114427011
Sequence AGAGTATTTAGCCCAGCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074549124_1074549128 23 Left 1074549124 10:114426943-114426965 CCAGCCTTGGGTTTGCCCTTCTC No data
Right 1074549128 10:114426989-114427011 AGAGTATTTAGCCCAGCACCTGG No data
1074549125_1074549128 19 Left 1074549125 10:114426947-114426969 CCTTGGGTTTGCCCTTCTCAGAT No data
Right 1074549128 10:114426989-114427011 AGAGTATTTAGCCCAGCACCTGG No data
1074549123_1074549128 24 Left 1074549123 10:114426942-114426964 CCCAGCCTTGGGTTTGCCCTTCT No data
Right 1074549128 10:114426989-114427011 AGAGTATTTAGCCCAGCACCTGG No data
1074549127_1074549128 7 Left 1074549127 10:114426959-114426981 CCTTCTCAGATTAAACAAAATAA No data
Right 1074549128 10:114426989-114427011 AGAGTATTTAGCCCAGCACCTGG No data
1074549126_1074549128 8 Left 1074549126 10:114426958-114426980 CCCTTCTCAGATTAAACAAAATA No data
Right 1074549128 10:114426989-114427011 AGAGTATTTAGCCCAGCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074549128 Original CRISPR AGAGTATTTAGCCCAGCACC TGG Intergenic