ID: 1074549129

View in Genome Browser
Species Human (GRCh38)
Location 10:114426996-114427018
Sequence TTAGCCCAGCACCTGGCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074549125_1074549129 26 Left 1074549125 10:114426947-114426969 CCTTGGGTTTGCCCTTCTCAGAT No data
Right 1074549129 10:114426996-114427018 TTAGCCCAGCACCTGGCACTTGG No data
1074549124_1074549129 30 Left 1074549124 10:114426943-114426965 CCAGCCTTGGGTTTGCCCTTCTC No data
Right 1074549129 10:114426996-114427018 TTAGCCCAGCACCTGGCACTTGG No data
1074549126_1074549129 15 Left 1074549126 10:114426958-114426980 CCCTTCTCAGATTAAACAAAATA No data
Right 1074549129 10:114426996-114427018 TTAGCCCAGCACCTGGCACTTGG No data
1074549127_1074549129 14 Left 1074549127 10:114426959-114426981 CCTTCTCAGATTAAACAAAATAA No data
Right 1074549129 10:114426996-114427018 TTAGCCCAGCACCTGGCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074549129 Original CRISPR TTAGCCCAGCACCTGGCACT TGG Intergenic