ID: 1074549667

View in Genome Browser
Species Human (GRCh38)
Location 10:114430704-114430726
Sequence GTAAGAAGCTAGAATGCAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074549667_1074549669 3 Left 1074549667 10:114430704-114430726 CCTACTGCATTCTAGCTTCTTAC No data
Right 1074549669 10:114430730-114430752 AAAGTGGCCCACACTCATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074549667 Original CRISPR GTAAGAAGCTAGAATGCAGT AGG (reversed) Intergenic
No off target data available for this crispr