ID: 1074549669

View in Genome Browser
Species Human (GRCh38)
Location 10:114430730-114430752
Sequence AAAGTGGCCCACACTCATAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074549666_1074549669 27 Left 1074549666 10:114430680-114430702 CCAAAATTGGAAGGATGCTTTTC No data
Right 1074549669 10:114430730-114430752 AAAGTGGCCCACACTCATAGTGG No data
1074549665_1074549669 28 Left 1074549665 10:114430679-114430701 CCCAAAATTGGAAGGATGCTTTT No data
Right 1074549669 10:114430730-114430752 AAAGTGGCCCACACTCATAGTGG No data
1074549667_1074549669 3 Left 1074549667 10:114430704-114430726 CCTACTGCATTCTAGCTTCTTAC No data
Right 1074549669 10:114430730-114430752 AAAGTGGCCCACACTCATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074549669 Original CRISPR AAAGTGGCCCACACTCATAG TGG Intergenic
No off target data available for this crispr