ID: 1074549780

View in Genome Browser
Species Human (GRCh38)
Location 10:114431850-114431872
Sequence CTCAAAAAGAAGGGGGGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 629
Summary {0: 1, 1: 0, 2: 7, 3: 49, 4: 572}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074549780 Original CRISPR CTCAAAAAGAAGGGGGGAAA TGG (reversed) Intronic
900522418 1:3112118-3112140 CCCAAAAATAAGGGGGGGAAAGG - Intronic
900892424 1:5458944-5458966 CTCTTAAAGAAGCAGGGAAATGG + Intergenic
900936623 1:5770198-5770220 CTGAAAAGGAAGGGCCGAAAAGG + Intergenic
901152058 1:7110271-7110293 TTAAAAAAAAAGGGGGGAAGGGG - Intronic
901152059 1:7110272-7110294 CTTAAAAAAAAAGGGGGGAAGGG - Intronic
901733380 1:11296517-11296539 CTCAAAACAAAGGGGGGGACAGG - Intergenic
902038665 1:13476207-13476229 CAAAAATAAAAGGGGGGAAAAGG + Intronic
902878827 1:19357474-19357496 CTCATAAAGAAGGCTGGAGATGG - Exonic
903257714 1:22114042-22114064 CTCAAAACAAAGAAGGGAAAGGG - Intergenic
904352110 1:29915251-29915273 CTCTAAAATAAAAGGGGAAAAGG + Intergenic
904372206 1:30056930-30056952 ATCCAAAAGAAGGCAGGAAAAGG + Intergenic
904681493 1:32232537-32232559 CAAAGAAAGAAGGCGGGAAAGGG + Intergenic
905148302 1:35905470-35905492 CAAAAAAAGAAGGGAGGAATGGG - Intronic
905608654 1:39328366-39328388 GTTAAAAAAGAGGGGGGAAAAGG + Intronic
905980040 1:42216839-42216861 ATCTAAAAGAAGGCAGGAAAAGG + Intronic
908471335 1:64446868-64446890 CTGAAACAGAAGGAAGGAAAAGG - Intergenic
908485542 1:64588797-64588819 TTTAAAAAGAAGGGGGCAAAGGG + Intronic
910037717 1:82808014-82808036 ATCATAAACAATGGGGGAAATGG + Intergenic
910750270 1:90621484-90621506 CTCAAGAAGAAGAGGGAGAAAGG - Intergenic
911208961 1:95119602-95119624 CTCAAAGAGAAAGAGGGAGAAGG - Intronic
911310573 1:96287936-96287958 CTGAAAGAGAAGGGGAGAAGGGG - Intergenic
911623114 1:100089956-100089978 AGCAAAAAGAAGGGAAGAAATGG + Intronic
911624270 1:100103382-100103404 CTCCTAAAAAAGGGGGGAATGGG + Intronic
912415978 1:109508844-109508866 CTCAAAAAGCAGCAGGGACAAGG + Exonic
912478795 1:109961792-109961814 GGCAAACAGATGGGGGGAAATGG + Intergenic
912785614 1:112600849-112600871 CTGAAAAACAAGGGAGAAAAAGG + Intronic
913123364 1:115762723-115762745 CTGAAAAAGAAGGCAAGAAAAGG - Intronic
914402148 1:147331755-147331777 CACATAAAGAAGGGGAAAAAAGG + Intergenic
914431212 1:147621271-147621293 GTTAAAAGGAAGAGGGGAAATGG + Intronic
914756122 1:150562430-150562452 CTCTAAAATAAGAGGGGAAAGGG - Intergenic
915406024 1:155660298-155660320 CTCAAAAAGAAGGGGAGCCAGGG - Exonic
915483423 1:156203221-156203243 CACATAAAGAACAGGGGAAAGGG - Intronic
915518626 1:156428628-156428650 CTCATAGGAAAGGGGGGAAAGGG + Intronic
916006490 1:160665800-160665822 ATCACAAAGAGGGTGGGAAACGG + Intergenic
916734307 1:167593928-167593950 CAAAAGAAAAAGGGGGGAAATGG - Intergenic
916948443 1:169755085-169755107 CCCAAAGAGAAGGGAGGAAAGGG + Intronic
917003122 1:170383371-170383393 GTTAAAAAGCAGGGGGAAAAAGG - Intergenic
917234179 1:172872905-172872927 CTCAAAAGGAAGGGAGGTGAGGG - Intergenic
917960322 1:180138487-180138509 GTCCAAAAGAAGGCAGGAAAGGG + Intergenic
919066767 1:192701619-192701641 CTCAAGAAAAAGGGGGAAGAAGG + Intergenic
919444986 1:197692157-197692179 CTTAAAGAGAAAGTGGGAAAGGG - Intronic
919558131 1:199086787-199086809 CTGAGAAAGAAGTAGGGAAAAGG - Intergenic
919682800 1:200453067-200453089 CTAAGAAAGAAGGGGAGAATGGG - Intergenic
920203611 1:204275827-204275849 CTCAAGAGGAATGGGTGAAAAGG - Intronic
920786764 1:209049989-209050011 CCCACAGAGAATGGGGGAAAAGG + Intergenic
921055753 1:211541318-211541340 CTGAGCAAGAAGGTGGGAAATGG - Intergenic
921133553 1:212240318-212240340 ACCAAAAACAAGGGGGAAAAAGG - Intergenic
921424981 1:214991059-214991081 TGCAAAAGGAAGGGGAGAAATGG - Intergenic
921727074 1:218535560-218535582 TTCAAAAATAAAGGGGCAAAAGG - Intergenic
922171609 1:223160139-223160161 CTGAAAAAGAAAGAGAGAAAGGG - Intergenic
924076047 1:240338368-240338390 CTCAAACATAAGGGGAAAAAAGG - Intronic
924381531 1:243469974-243469996 GTAACAAAGAAGGGTGGAAAGGG - Intronic
1063711478 10:8483077-8483099 CTCAAAAGTAAGGGGGAAAACGG + Intergenic
1064305889 10:14165847-14165869 CTCCAAAAGAGGGGAGGAAGAGG + Intronic
1066180383 10:32956827-32956849 CTATAAAAGAAGGGCTGAAAAGG + Intronic
1066680377 10:37932104-37932126 CTCAAAAAAAAGGGGGGGGGAGG - Intergenic
1067572736 10:47383872-47383894 CTGAAAAAACAGGGGGGAGAGGG + Intronic
1068165564 10:53327809-53327831 CTCAAAAAGAGAGAGAGAAAGGG - Intergenic
1068990297 10:63143232-63143254 CAAAAATAGAAGTGGGGAAAAGG + Intronic
1069234775 10:66057128-66057150 CTCAAAAACAGGCAGGGAAAAGG - Intronic
1069987747 10:72295877-72295899 CTGAAAAGGAAGGAGGGAAGAGG - Intergenic
1070123171 10:73598082-73598104 CTCAAAAAAAAGGTTGGAAAAGG + Intronic
1070253725 10:74796169-74796191 CTCAAAAAAAAGGGGGGTGGTGG - Intergenic
1070516903 10:77216356-77216378 ATGAAGAAGAAGGGGGGAAGAGG + Intronic
1070913785 10:80139674-80139696 CTCAAAAAAAAGTGGGGAGGGGG + Intronic
1072077867 10:91996151-91996173 TTCAAAAAGAAGGGAAAAAAAGG - Intronic
1073274759 10:102300632-102300654 TTCAGGAAGCAGGGGGGAAAGGG + Intronic
1074534330 10:114317855-114317877 CTCAAAAAAAAGGGCGGGAGTGG + Intronic
1074549780 10:114431850-114431872 CTCAAAAAGAAGGGGGGAAATGG - Intronic
1074718016 10:116237856-116237878 GTCACAAGGAAGTGGGGAAAAGG + Intronic
1075818868 10:125288187-125288209 CTTAAAAAGAAGGGGGGATTTGG + Intergenic
1076033308 10:127177492-127177514 CTCAAACACAAGGGGGGAAAAGG - Intronic
1076742306 10:132492624-132492646 TTCAAAGAGCAGGGGGGACAAGG - Intergenic
1077652951 11:3990956-3990978 CTCCAAAAGGAGTGGGGATAGGG - Intronic
1077832401 11:5888180-5888202 ATCAAAAATAAAGAGGGAAAGGG + Intronic
1077957920 11:7040583-7040605 TTCAAAACAAAGTGGGGAAATGG - Intronic
1078253992 11:9641813-9641835 CTCAAAAAAAAGGGGGGGTGGGG - Intergenic
1080168210 11:29266361-29266383 TTCAAAAAAGATGGGGGAAAAGG - Intergenic
1080726671 11:34904963-34904985 CTCAAAAGGAGAGGTGGAAATGG - Intronic
1080754195 11:35179776-35179798 CTGAGAAAGAAGTGGGGGAATGG + Intronic
1081456634 11:43229693-43229715 CTCAAACAGAGGAGGGGAAGAGG - Intergenic
1082565568 11:54674215-54674237 CTGAAAAAGCTGGGGGTAAAAGG + Intergenic
1082711316 11:56557180-56557202 CTAAGGAGGAAGGGGGGAAATGG + Intergenic
1082974858 11:59061390-59061412 CTGAAAAATAAGGAGGGAAGTGG - Intergenic
1082979281 11:59105120-59105142 CTGAAAAATAAGGAGGGAAGTGG - Intergenic
1083996312 11:66274773-66274795 CTCAACAGGGAGGGGGGACAGGG - Intronic
1084059058 11:66657736-66657758 CTCAAAAAAAAGGTGGGGGAGGG - Intronic
1084073768 11:66756326-66756348 GAAAAAAAAAAGGGGGGAAAAGG - Intronic
1084594522 11:70109070-70109092 CTCAAGAAGGAGGGGAGGAAAGG - Intronic
1086013767 11:82138838-82138860 CTCAAAAAGAAGAGAGGGAGGGG - Intergenic
1086259625 11:84923465-84923487 CTCAGGAAGGAGGGGGGGAAAGG + Intronic
1086332301 11:85766126-85766148 TTCAAAAAGAAGGCTGGTAACGG + Intronic
1086802025 11:91187634-91187656 TTAAAAAAGAAGCAGGGAAAAGG - Intergenic
1087084423 11:94202145-94202167 CTCCAAAACAAAGGTGGAAATGG + Intergenic
1087213009 11:95462214-95462236 CACAAAGAGGATGGGGGAAAAGG - Intergenic
1087293102 11:96340918-96340940 TTCAAAAGGGAGAGGGGAAATGG + Intronic
1087863730 11:103197263-103197285 CTGAAATAGAAGGAGGAAAATGG + Intronic
1087956919 11:104299872-104299894 AATAAAAAGAAGGGAGGAAAGGG - Intergenic
1088063805 11:105690510-105690532 CTTAAAAAGAGGGGGAGAGAGGG + Intronic
1088702332 11:112424559-112424581 CTGAAAGAGAAGTGGGAAAAAGG + Intergenic
1090247454 11:125226634-125226656 ATCTAAAAGAAGAGGGGAATAGG - Intronic
1090810934 11:130242141-130242163 AACAAATAGAAGGGGAGAAATGG - Intronic
1090948509 11:131452104-131452126 CTCGAAAAGAAGTGGGGGGAGGG + Intronic
1091015888 11:132050420-132050442 CTAACAAAGTTGGGGGGAAAGGG + Intronic
1093508761 12:19902036-19902058 CTCAAAAAGAAAGAGGAAATAGG - Intergenic
1094219593 12:27977658-27977680 TTTAAAAGCAAGGGGGGAAAAGG - Intergenic
1094645518 12:32319898-32319920 CTAAAAAAGATGGAGGGAGAGGG - Intronic
1095178782 12:39123215-39123237 TAAAAAAAGATGGGGGGAAATGG - Intergenic
1095431533 12:42139878-42139900 TGCAGAAAAAAGGGGGGAAAAGG + Intronic
1095726339 12:45457107-45457129 CTCAAAAAGAGGGAGAGAGATGG - Intergenic
1096036965 12:48481043-48481065 CTCCAAAAGAAGGGAGGGAGGGG + Intergenic
1096154045 12:49331999-49332021 CTCAAAAAGCAAGGGGAACAGGG - Intergenic
1096638192 12:52974496-52974518 CTCAAAAAAAAAGGGGGTAGGGG + Intergenic
1096797076 12:54084665-54084687 CTCATAAAGAAGGAGATAAATGG - Intergenic
1097293274 12:57937870-57937892 CTCAAAAAAAAGGGGCGGCAGGG - Intergenic
1097557757 12:61160862-61160884 CTTAAAAAGAGAGAGGGAAATGG - Intergenic
1097926149 12:65129527-65129549 GTCAAAAAGATGGGTGAAAATGG - Intergenic
1098229192 12:68355308-68355330 CTCAAAAGTAGGGGAGGAAAAGG + Intergenic
1098433015 12:70440929-70440951 AACAAACTGAAGGGGGGAAAAGG + Intergenic
1099399975 12:82192254-82192276 TAGAAAAAGTAGGGGGGAAAAGG + Intergenic
1099616427 12:84941503-84941525 CTCAAAAAAAAAGAAGGAAAAGG + Intergenic
1100126112 12:91427647-91427669 CTCACAAAGCAGGAGTGAAAAGG + Intergenic
1100372847 12:93984503-93984525 TTCAAAAATAATGGGAGAAAAGG + Intergenic
1101110713 12:101482879-101482901 CTCCAGCAAAAGGGGGGAAAAGG + Exonic
1101270557 12:103139518-103139540 CTCAAAAAGAAGAGCAAAAAGGG + Intergenic
1101483510 12:105127669-105127691 AATAAAAAGAAGGGGGAAAAAGG - Intronic
1101635951 12:106541392-106541414 TTCAAAACAAAGGGGGAAAAAGG - Intronic
1102208712 12:111108688-111108710 GGCAAAGAGAAGGGGGAAAATGG - Intronic
1102468614 12:113145762-113145784 CTCAAAAGGAAGGAGGGGGAGGG - Intergenic
1102515902 12:113446469-113446491 ATCCAAAAGAAGGGAGTAAAGGG + Intergenic
1102622752 12:114209843-114209865 CTCTAAAAGGATGGGTGAAATGG + Intergenic
1102861834 12:116342737-116342759 AACAAGAAGAAGTGGGGAAATGG - Intergenic
1103316704 12:120062091-120062113 CCCAAACAGGAGGTGGGAAAGGG + Intronic
1103500396 12:121397318-121397340 CTGAAGGAGGAGGGGGGAAATGG - Intronic
1104629768 12:130390756-130390778 AACAAAAAGAAAGGGTGAAAGGG - Intergenic
1104645304 12:130493273-130493295 AACAAAAAGAAGGCAGGAAAGGG - Intronic
1105637777 13:22232053-22232075 ATCAAAAAGCAGATGGGAAAAGG - Intergenic
1106308189 13:28532064-28532086 AAGAAAAAGAAAGGGGGAAACGG + Intergenic
1106421339 13:29588847-29588869 CTGAAAAAGAAAAGGGGAAAAGG + Intronic
1106996050 13:35481455-35481477 CTGAAAAAAAAATGGGGAAAGGG + Intronic
1107282567 13:38753911-38753933 TGCAACAAAAAGGGGGGAAAAGG - Intronic
1107838959 13:44436096-44436118 CTGAAAAAGAGGAGGGAAAAAGG + Intronic
1108096507 13:46907380-46907402 GTCAAAAAGAAGAGGAGAAGAGG - Intergenic
1108184581 13:47875796-47875818 CTCAAAAAGAGGGGTGGGGATGG + Intergenic
1108716490 13:53084060-53084082 CTGTAAAAAAAGGGGGGAGAGGG - Intergenic
1109008401 13:56908561-56908583 CTCCAAAAGCAGGGAGGAAAGGG + Intergenic
1109283850 13:60388625-60388647 CTCAGAATGAAAGGAGGAAAAGG - Intergenic
1111063884 13:83064263-83064285 GTCAAAAAAAAGGGAGTAAATGG - Intergenic
1111433963 13:88181860-88181882 GTCAAAAAGATAGTGGGAAAGGG - Intergenic
1112919779 13:104597874-104597896 CTCAGAAAGAAGGAGGGCCAGGG - Intergenic
1113055918 13:106267704-106267726 TTAAAAAAAAGGGGGGGAAAGGG - Intergenic
1113055919 13:106267705-106267727 ATTAAAAAAAAGGGGGGGAAAGG - Intergenic
1113087639 13:106584685-106584707 CTAGAACAGAATGGGGGAAATGG - Intergenic
1115060799 14:29187538-29187560 CAGAAAAAGAAGCTGGGAAAGGG - Intergenic
1115155632 14:30336149-30336171 CTCAAAGAGATGGAGGAAAAGGG + Intergenic
1115829820 14:37325261-37325283 ATCAAAAAGACGAGGGTAAACGG - Intronic
1116207019 14:41881598-41881620 CTCAGAAAGAAAGGGAGAATGGG - Intronic
1116381809 14:44278478-44278500 CTCAAAAAGAAGACAGTAAATGG - Intergenic
1116849674 14:49894799-49894821 CTCATAAGGAAGGGGGGGGAAGG - Exonic
1118143981 14:63116129-63116151 CTAAATAGGAAGGCGGGAAAAGG + Intergenic
1118341472 14:64896878-64896900 CTCCAAAAGAAGGCGTGAAAAGG + Intergenic
1119235653 14:73017001-73017023 AACTAAAAGAAGGAGGGAAAAGG + Intronic
1119519643 14:75276840-75276862 CTCATAAAAAGGGAGGGAAACGG - Intergenic
1119867357 14:77985098-77985120 CTCAAAAAGAAAGGGAAAGATGG - Intergenic
1120748914 14:88179364-88179386 CACAAAAAGAAGAGGAGAGACGG + Intergenic
1120774619 14:88420145-88420167 CACCAAGAGAAGGTGGGAAAGGG + Intronic
1120796366 14:88637361-88637383 TTCAAAATAAAGGGGAGAAAAGG + Intronic
1121207122 14:92179112-92179134 CTCAGAAAGAAAGAGAGAAAGGG + Intergenic
1121333993 14:93065630-93065652 CTAAAGAAGAAGGGGAGAATGGG - Intronic
1121449274 14:93997117-93997139 CCCAAGAAGATGGGGAGAAAGGG - Intergenic
1121478972 14:94244773-94244795 TCCAAGAAGAAGGGGAGAAAAGG - Intronic
1121593837 14:95143365-95143387 CTGGAAAAGAAAAGGGGAAAGGG - Intronic
1122185998 14:99996650-99996672 CTCAAAAAAAAAGGGGGAAGGGG - Intronic
1122379622 14:101293163-101293185 CTCCAAGAGAAGAGGGGACAGGG + Intergenic
1122648410 14:103210336-103210358 CTATAAAATAACGGGGGAAAAGG + Intergenic
1122816497 14:104316608-104316630 CTCCAAAGGAAGGGTGGAAATGG - Intergenic
1124884468 15:33672112-33672134 GTTAAAAAGAAGGTGGGAAAGGG - Intronic
1125076651 15:35626932-35626954 CTCAAAGAGAAGAGGAGGAATGG - Intergenic
1125778076 15:42236422-42236444 ATGAAAAAGAAGGGAAGAAATGG + Intronic
1125919709 15:43518191-43518213 ATGGAAAAGAAGGGAGGAAAGGG + Intronic
1127314897 15:57785589-57785611 GTTTCAAAGAAGGGGGGAAAAGG + Intergenic
1128084490 15:64876451-64876473 CTAAAAAAGAAGGGAGGGAATGG + Intronic
1128426506 15:67546713-67546735 TACAAAAAGAAGAGGGGAGAGGG - Intronic
1129057979 15:72835701-72835723 CTCAATGAGGAAGGGGGAAAGGG + Intergenic
1129135642 15:73548077-73548099 CTCCATAAGAAAGTGGGAAAAGG + Intronic
1129144106 15:73632631-73632653 CTTAAAAATAAGGGGGAAATTGG - Intronic
1129632473 15:77276146-77276168 CTCAAAAGGAAAGGAGAAAAAGG + Intronic
1129867199 15:78918218-78918240 CTCAAAAAAAAGAGGGGGAGGGG - Intergenic
1130022673 15:80244092-80244114 CTCACCAAGGAGGTGGGAAATGG + Intergenic
1130347889 15:83066297-83066319 CTCAAAAAAAGCGGGGGGAAGGG + Intronic
1131601174 15:93850567-93850589 CTCAAAGAAAAGAGGGGGAATGG - Intergenic
1131764361 15:95659316-95659338 CTGAAAAAGCAGGGAGGAATGGG - Intergenic
1131791872 15:95973938-95973960 ATCAGAAAGAAGGGGAAAAAGGG - Intergenic
1133096316 16:3449071-3449093 CTCATAAAGAAGGAGCCAAAGGG + Intronic
1133824246 16:9262912-9262934 CTCAAAAAGAGGGTGGGGGAGGG - Intergenic
1134116679 16:11553933-11553955 CTCAAAAAGAAAGGAGGACCGGG + Intronic
1134140973 16:11718687-11718709 CACAAAAAAATGGGGTGAAAAGG + Intronic
1134354821 16:13471941-13471963 CACAAAGACAAGGGAGGAAAGGG + Intergenic
1134638952 16:15813828-15813850 CACACAAAAGAGGGGGGAAAAGG + Intronic
1135410377 16:22229700-22229722 CAAAAAAAGAAGAGGGGGAAAGG + Intronic
1135958820 16:26979022-26979044 ATCAAAAAGGTGGGGGGAAGGGG - Intergenic
1136145653 16:28314977-28314999 CTCAAAAAAAAGGGAAAAAAGGG + Intronic
1136466731 16:30449469-30449491 CAAAAAAAAAAAGGGGGAAATGG - Intergenic
1138324207 16:56148903-56148925 CTCAGAAGGAAGGGGAAAAATGG + Intergenic
1138434996 16:56993303-56993325 GTTAAAAAGAAAGAGGGAAAGGG - Intronic
1139398942 16:66664732-66664754 CTCCAAAAGAAAAGAGGAAAGGG + Intronic
1139788906 16:69416367-69416389 CTGAAAGAGTTGGGGGGAAATGG - Intergenic
1140020410 16:71233050-71233072 CTCAAAAAAAAGGGGGGGAGGGG + Intergenic
1140232863 16:73132282-73132304 CTCAAAAAAAAGAGTGGAGAGGG + Intronic
1142366248 16:89651496-89651518 CACAAAAATAAGGGCAGAAAAGG + Intronic
1142736105 17:1900783-1900805 CTCAAAAAAAGGGGGAGAAAGGG + Intergenic
1142883957 17:2901301-2901323 TTCAAAGAGAAGGGTGGCAAGGG - Intronic
1143091610 17:4452430-4452452 CTCTAAAAGTGGGTGGGAAAGGG + Intronic
1143231994 17:5364231-5364253 CAGAAAAAGAAGTGGGAAAAGGG + Intronic
1143903062 17:10189085-10189107 CCCAAAAAAAAGGAGGTAAAAGG - Intronic
1144301864 17:13928655-13928677 CTGAAAAAGGAGTGGGCAAAGGG + Intergenic
1144622285 17:16825088-16825110 CCCCAAAAGGAGGGGGGTAAAGG + Intergenic
1144956319 17:19020587-19020609 CTGAAAAATTAGGGGGGAAATGG + Exonic
1145148090 17:20496752-20496774 CCCCAAAAGGAGGGGGGTAAAGG + Intergenic
1146967148 17:37042004-37042026 CTCAAAAAGAAAATGGGCAAAGG - Intronic
1147454670 17:40529775-40529797 CTCAAAAAAAAAGGGGGGACTGG - Intergenic
1147574256 17:41589419-41589441 CCCCAAAAGGAGGGGGGTAAAGG + Intergenic
1147965506 17:44192381-44192403 TCCAACCAGAAGGGGGGAAAAGG + Exonic
1149174039 17:53847952-53847974 CTTAAAAGCAATGGGGGAAATGG - Intergenic
1149186426 17:54003222-54003244 TGCTAAAAGCAGGGGGGAAAAGG - Intergenic
1149353191 17:55812767-55812789 CCCAATAAGATGGGGTGAAAAGG - Intronic
1149949768 17:60973227-60973249 GGCAATAAGAAGGGGAGAAAGGG + Intronic
1150008776 17:61486409-61486431 CTCAATAAAAAGGGGGCACATGG + Intergenic
1150582599 17:66488666-66488688 CTCCTAAAGAAGGGGGAAAGAGG + Intronic
1150744633 17:67806649-67806671 CTCAAAAAAAAGGGGGGTGGTGG - Intergenic
1151105064 17:71603577-71603599 TTTAAACAGTAGGGGGGAAATGG - Intergenic
1151785721 17:76273991-76274013 CTCAGGAAGATGGAGGGAAAGGG - Intergenic
1151824312 17:76515233-76515255 CACAAAAAGAAGGCGAGAAGGGG + Intergenic
1203178214 17_KI270729v1_random:35513-35535 CTCGAAAGGAAGGGGTGGAATGG + Intergenic
1153341164 18:3976355-3976377 CTCAAAAAAAAGTGGTTAAAAGG + Intronic
1154331570 18:13433748-13433770 CCCTAAAACTAGGGGGGAAATGG - Intronic
1154372932 18:13781135-13781157 CTCAAAAAAAAAGTGGGCAAAGG + Intergenic
1155982092 18:32191547-32191569 TTCAAAAATTGGGGGGGAAAAGG - Intronic
1156025125 18:32644959-32644981 CTCTAAAAGATGGGGGGGAAAGG - Intergenic
1156339555 18:36199151-36199173 CTAGTAAAAAAGGGGGGAAAAGG - Intronic
1158169981 18:54586614-54586636 CTAAGAAGGATGGGGGGAAAAGG - Intergenic
1158226426 18:55206015-55206037 ATCAGAAGGAAGTGGGGAAAAGG + Intergenic
1158292677 18:55958868-55958890 TTTAAACAGAAGTGGGGAAAGGG + Intergenic
1159035605 18:63274652-63274674 TTCAAAAACAAGGGTGGGAAGGG - Intronic
1159291476 18:66428164-66428186 CTCAAAAAAAAGGGAAGAAAGGG - Intergenic
1159547313 18:69855626-69855648 ACCAAAAAAAAGAGGGGAAAAGG + Exonic
1159980556 18:74774202-74774224 CACAAAAAGATTGGGGAAAATGG + Intronic
1160525918 18:79536442-79536464 ATCCAAAAGAAGGCAGGAAAGGG - Intergenic
1160925786 19:1544840-1544862 CTCAGAAAGAAAGGAGGGAAGGG - Intergenic
1163811273 19:19433773-19433795 CTCAAAAAAAGGGGGGGTATGGG - Intronic
1165010731 19:32844467-32844489 CTGAAAAGCATGGGGGGAAAGGG - Intronic
1166309141 19:41952577-41952599 CTCAAAAAGAAGGCGGGGGCGGG - Intergenic
1166401202 19:42481814-42481836 CTCAAAAGGAACGGGCGAAGAGG - Intergenic
1167409040 19:49334159-49334181 CACAAAAACAAGTGGGGAAGGGG + Intergenic
1167646144 19:50706156-50706178 CTCAAAAAAAAGGGGGGGTTGGG + Intronic
1168081525 19:54013675-54013697 ATCAAAAAGGTGGGGGGAAGGGG + Intergenic
925954885 2:8954116-8954138 CTCATTAAGAAGGGAGAAAAAGG - Intronic
926096327 2:10082865-10082887 ATCAAAAAAAAGGGGGGGAGAGG - Intergenic
927096499 2:19751285-19751307 CACAGAAGGAAGCGGGGAAAAGG + Intergenic
927109469 2:19853876-19853898 ATCATAGAGAAGGGGAGAAAGGG + Intergenic
927120302 2:19953833-19953855 CTCGAAAAGAAGGGAGAGAAAGG - Exonic
927555668 2:24029721-24029743 TTTTAAAGGAAGGGGGGAAAAGG + Exonic
927797346 2:26061755-26061777 CTCAAAAACAAGGGGGGGTGGGG - Intronic
927802969 2:26118312-26118334 CTCAAAAAAAAGGGGGAGGAGGG - Intronic
927939472 2:27094709-27094731 CTCCAAAAGGAGTGGGGAGAGGG - Intronic
928259168 2:29751067-29751089 CTCAAAAGGAAGGGGAGGAGAGG + Intronic
929061450 2:37928911-37928933 GTCCAAAAGAAGGCAGGAAAAGG - Intronic
929867593 2:45731395-45731417 CCAAAAAAGAAGTGGGGAGATGG + Intronic
931084256 2:58811565-58811587 CTCAAATGGAAGGAAGGAAAGGG - Intergenic
931118448 2:59190101-59190123 CTCAGGAAGAAGGCGGGAAGGGG - Intergenic
931295829 2:60924190-60924212 TACATAAAGCAGGGGGGAAAGGG - Exonic
931690174 2:64829079-64829101 CTAAAAAGAAAGGGGGAAAAGGG - Intergenic
931690175 2:64829080-64829102 ACTAAAAAGAAAGGGGGAAAAGG - Intergenic
931824487 2:65985688-65985710 GTCAAAAAAGAAGGGGGAAATGG + Intergenic
931825501 2:65996447-65996469 TTCAAAAAGGAGGAAGGAAATGG - Intergenic
931987497 2:67755899-67755921 TTTAAAAAGCTGGGGGGAAATGG + Intergenic
932239281 2:70144288-70144310 TTCAAAAACGTGGGGGGAAAAGG - Intergenic
932605911 2:73165513-73165535 CTTAAAATGGAGTGGGGAAAAGG - Intergenic
932635327 2:73383255-73383277 CTAAAAAAGAAAGAGAGAAAGGG - Intergenic
933249673 2:80015244-80015266 GGCCAAAAGAAGGGGGGAAAAGG - Intronic
933551235 2:83779019-83779041 ATCCAAAATAAGTGGGGAAATGG - Intergenic
934066152 2:88343996-88344018 CTCCAAAGGGAGGGGGGAAAGGG + Intergenic
934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG + Intergenic
935180380 2:100684606-100684628 ATTCAAAAGAAGGGAGGAAAGGG + Intergenic
935443464 2:103131224-103131246 AGCAAAAAGAAAAGGGGAAAAGG + Intergenic
936973550 2:118197370-118197392 CTGAAAAAGAAAGGGACAAAGGG + Intergenic
937732954 2:125257198-125257220 CACAAAAATAAGTGTGGAAATGG - Intergenic
938041995 2:128083659-128083681 CTCAAAAAAAAAGGGGGGGAGGG - Intergenic
939141240 2:138357277-138357299 CTCAGTAAGAAGTGGTGAAAGGG + Intergenic
939154066 2:138502779-138502801 CTCAAAAAGAATTAGGAAAAAGG - Intronic
939574567 2:143880771-143880793 ACCGAAAAGAAGGGGGGCAATGG + Intergenic
939588934 2:144039686-144039708 CTCAAACAGAAGTCAGGAAAAGG - Intronic
940608687 2:155962717-155962739 CTCAAAAATAAAGGGGGGAATGG - Intergenic
941976151 2:171407329-171407351 CTCTAAAAGCGGGGGGGAAATGG + Intronic
942120743 2:172774213-172774235 CTGAAGAAGAAAGGGGCAAAAGG - Intronic
942291672 2:174478508-174478530 CTAAAAAAGAAGGCTGGACATGG - Intronic
942370235 2:175276106-175276128 CCAAATAAGAATGGGGGAAATGG - Intergenic
942423310 2:175831546-175831568 ATCCAAAAGAAGGCAGGAAAAGG + Intergenic
942523246 2:176826560-176826582 AACAAAAAGAGGAGGGGAAAGGG + Intergenic
943288781 2:186042178-186042200 CTCCAAAAGAAAGGGGTAACAGG + Intergenic
943522794 2:188974621-188974643 CTCACAAAGAGGGGTGTAAAGGG + Intronic
943750052 2:191501398-191501420 CAGAAAACGAAGGGGAGAAATGG + Intergenic
944075803 2:195729646-195729668 ATCCAGCAGAAGGGGGGAAATGG - Intronic
944370620 2:198978678-198978700 CTCCATAAAAAGGGGGCAAAGGG + Intergenic
944508333 2:200438774-200438796 CTGGAATAGCAGGGGGGAAAAGG + Intronic
944625026 2:201561871-201561893 CTCAAAAAAAAGGAAAGAAAAGG + Intronic
946552522 2:220818583-220818605 TTGAAAAATAAGGGGAGAAATGG - Intergenic
947009541 2:225550567-225550589 CATAAAAAGAAGTAGGGAAATGG + Intronic
947206703 2:227667431-227667453 CTCATAGAAAAGGTGGGAAATGG - Intergenic
947249903 2:228090287-228090309 GTCCAAAAGAAGGGGGTAATAGG - Intronic
948018933 2:234714488-234714510 GTCAAGAAGAAGGGGTGGAATGG - Intergenic
948355242 2:237372504-237372526 ATCAAAGAGAAGGGGAGCAAAGG + Intronic
948745516 2:240089986-240090008 CACAAACAGAAGGCAGGAAAAGG + Intergenic
1168982090 20:2013609-2013631 CTCCAAAAGAAGCCAGGAAAGGG + Intergenic
1169054735 20:2611285-2611307 CTCAATAATAAGGAGGGAAGGGG - Intronic
1169733058 20:8807656-8807678 ATCAACTTGAAGGGGGGAAAAGG - Intronic
1170832017 20:19850972-19850994 CAAAAAAAGAAAGGGAGAAAAGG + Intergenic
1171289126 20:23970271-23970293 CTCAGAAAGAAGGGTGCCAAGGG + Intergenic
1171848931 20:30294522-30294544 CTCACAAAGAAGGAGATAAATGG - Intergenic
1172822455 20:37749509-37749531 CTCAGAAAACAGGAGGGAAATGG - Intronic
1173394781 20:42669181-42669203 CTCAAAAAGATGTGGAGAAAGGG - Intronic
1173887422 20:46472637-46472659 CTGAAAAAGAAGAGGGATAAAGG + Intergenic
1173941387 20:46914043-46914065 CTCAAAACGAAGAGGAGGAACGG - Intronic
1174290183 20:49502845-49502867 ATAAAAAAGAAGGGGTGAAATGG - Intergenic
1176019710 20:62956437-62956459 CTCAAAGAGAACAGGGGAGAGGG - Intronic
1176513730 21:7767559-7767581 CTCAAAAAGAAAGAGAGAGAAGG - Intronic
1176957284 21:15120424-15120446 TTCAAGAAGAAGGGAGAAAATGG + Intergenic
1177363078 21:20099513-20099535 TTTACAAAGAAGGGAGGAAATGG - Intergenic
1177501169 21:21956952-21956974 CTGAAAAAAAAGGAGGAAAAAGG - Intergenic
1178647843 21:34398083-34398105 CTCAAAAAGAAAGAGAGAGAAGG - Intronic
1178867854 21:36345246-36345268 CTCAAAAAAAAGGAAGGGAAAGG - Intronic
1179380758 21:40897197-40897219 AGCCAAAACAAGGGGGGAAAAGG + Intergenic
1179560868 21:42215333-42215355 CTGAACATGAAGGGGAGAAAGGG - Intronic
1181813269 22:25418377-25418399 CTCAAAAAGCCGGGGGTAAAAGG + Intergenic
1182076396 22:27498292-27498314 CTCAAAAGGGAGGGAGGAGAGGG + Intergenic
1182145882 22:27996436-27996458 CTTAAAAGGAAGGGGACAAAAGG - Intronic
1182708340 22:32304129-32304151 CTCAAAAAAAAGAAAGGAAAAGG - Intergenic
1182918630 22:34059256-34059278 CTCCAAACAAAGGAGGGAAAGGG - Intergenic
1183272575 22:36871401-36871423 CTCAGAAAGCAGGTGGGGAAGGG - Intronic
1183686061 22:39362146-39362168 CTCAAGAAAAAGGGGGAAATTGG - Intronic
1183694100 22:39410106-39410128 CTCAAAAAGAAGAAGAAAAACGG - Intronic
949189034 3:1229146-1229168 CCTAAATAGAAGGTGGGAAAGGG + Intronic
949349300 3:3109135-3109157 ACCAAAAAAAAGGGGGAAAAAGG - Intronic
949694480 3:6678632-6678654 CTCATAAAGGAGAGGGGAGAGGG - Intergenic
950403832 3:12792082-12792104 CTCAATAAAAAGGAGGGAAATGG - Intergenic
950422766 3:12908447-12908469 CTCAAAAAGGAGTCGGGCAACGG - Exonic
950562590 3:13743379-13743401 CTCCAAAAGGAGGAGGGAGAGGG - Intergenic
950676114 3:14555334-14555356 CTCAACAGGAAGGAGAGAAAAGG + Intergenic
950699037 3:14727409-14727431 CACAAAAAGAAGGGAGGAGCAGG - Intronic
950843990 3:15996755-15996777 TTCAACAAGGAGAGGGGAAAAGG - Intergenic
951539224 3:23766407-23766429 CTCAAAAAGAAGAAGAAAAAGGG - Intergenic
952107317 3:30085280-30085302 CTAAATAGGAAGTGGGGAAAAGG + Intergenic
952148299 3:30558041-30558063 ATCAACAAGTTGGGGGGAAATGG + Intergenic
953221757 3:40978112-40978134 CTCCAAAGGTAGGAGGGAAAAGG + Intergenic
953278788 3:41531438-41531460 CTCAAAAAGAGGGGAGGGGAGGG + Intronic
953326702 3:42017492-42017514 TTTGAAAAGAAGGGGGGAAAAGG - Intronic
953362158 3:42307283-42307305 AACAATAAAAAGGGGGGAAAGGG + Intergenic
953485362 3:43289401-43289423 TTGAAAAGGAAGGAGGGAAATGG + Intronic
954779423 3:53047675-53047697 CTATTAAAGTAGGGGGGAAATGG - Intronic
955067024 3:55542689-55542711 GTCAATGAGAAGGGGAGAAAGGG - Intronic
955294390 3:57721825-57721847 CCCAAAAAGGAGTGGGGAATTGG - Intergenic
955487360 3:59448280-59448302 CTCAAAAAGAAAGAGGCCAAAGG - Intergenic
955529459 3:59858222-59858244 AAAAAAAAGAAGGTGGGAAAAGG - Intronic
955893112 3:63671097-63671119 CTCAAACAGAAGGGGTAGAAAGG + Intronic
956260446 3:67334616-67334638 CTGATAAAGAAAGGGGGAAATGG + Intergenic
956478395 3:69648007-69648029 CTCAAAAAGCCTGGTGGAAAAGG - Intergenic
956527320 3:70179264-70179286 CTCAAAAAGAAGGGGAACCAAGG - Intergenic
957279093 3:78126981-78127003 CTCAAATAGAGGCGTGGAAATGG - Intergenic
958452983 3:94296823-94296845 CACCAAAAGAAGGGGGCAAAAGG - Intergenic
958648380 3:96902737-96902759 ATTAAAAGGAAGGGGAGAAAAGG - Intronic
959755134 3:109888360-109888382 CTCAAAAAGAGGGGAGGAGATGG - Intergenic
959901327 3:111664816-111664838 CTGTACTAGAAGGGGGGAAATGG + Intronic
959902101 3:111673021-111673043 CTGAAAAATAAGGGGAAAAAAGG + Intergenic
960988242 3:123294382-123294404 GTCAAATACAAAGGGGGAAAAGG + Intronic
961011727 3:123440809-123440831 CTCAAAAAGGAAGGGGGGATTGG + Intronic
961415956 3:126757003-126757025 CTAAAAAAGAAAGGAGGAAGAGG - Intronic
961853488 3:129845455-129845477 CTCAAAATGAAGGTGAGGAAAGG + Intronic
963461611 3:145621079-145621101 TACAAAAAAAAGGGGAGAAAAGG + Intergenic
964135519 3:153340928-153340950 TACAAAAAAAAGGGGGGAGAGGG - Intergenic
965037231 3:163455225-163455247 CTAAAATAGAATGAGGGAAATGG - Intergenic
965153490 3:165013745-165013767 CTCTAAAGGAAGGGGAGAAATGG + Intronic
965421380 3:168463358-168463380 CTCAAGAAGAAAGAAGGAAAGGG + Intergenic
966575738 3:181500718-181500740 CTCAAAAAGAAAAAGGAAAAAGG - Intergenic
966823207 3:183941438-183941460 CTCAAACAGAAAGCAGGAAATGG + Intronic
967117726 3:186356889-186356911 CTGGAAGAGAAGGGGGAAAAGGG - Intronic
967118034 3:186359969-186359991 CTGGAAGAGAAGGGGGAAAAGGG - Intronic
967386718 3:188919218-188919240 CTCTTACAGAAGGGGAGAAAAGG - Intergenic
967433733 3:189419882-189419904 CTGAAGATGAAGGGGGAAAAGGG + Intergenic
967527185 3:190508531-190508553 CTGAAAGACAAGAGGGGAAAGGG - Intergenic
967628935 3:191720153-191720175 CCCAAAAGTAAGGGGGAAAAAGG - Intergenic
967686753 3:192426225-192426247 CTATAAAAGGAGGGGGGAAATGG + Intronic
967757531 3:193186900-193186922 CTCAAAAGAAAGTCGGGAAAGGG - Intergenic
967994329 3:195155215-195155237 CTCAGAAAGAGGGGGTGAAGAGG - Intronic
969051675 4:4377687-4377709 CTGAGAAACAAGGGGAGAAAAGG + Intronic
969318343 4:6395472-6395494 CTCCACAAGGAGGGAGGAAAGGG - Intronic
969712812 4:8853851-8853873 CTCAAAAAAAAGGGGGGCGGGGG + Intronic
970172850 4:13306457-13306479 CACAGAAAGAAGGTGGGAGATGG + Intergenic
970236448 4:13963635-13963657 CAAAAAAAAAAGGGGGGGAAAGG - Intergenic
970379036 4:15487952-15487974 ATAAAAAAGCAGGGGGGAGACGG - Intronic
970472057 4:16388817-16388839 CTCAAAGAGAAATGGGGAAAGGG - Intergenic
971231538 4:24804190-24804212 TTCAAAAAGAAGGAGGGTACAGG + Intergenic
971569277 4:28189313-28189335 TTCAAAAAGAAGGCATGAAAAGG - Intergenic
971656847 4:29358710-29358732 TTCAAAATGAAGGGGAGATAAGG - Intergenic
973588604 4:52417461-52417483 CACAAAAAGCAGGGGAGACAAGG + Intergenic
973775384 4:54236967-54236989 CTCAAAAAAAAAGTGGGCAATGG - Intronic
973947463 4:55973378-55973400 CTCAGAATGAAGGTGGGAAATGG - Intronic
973957589 4:56078405-56078427 CTCAAAAAGAAAGGAAAAAAGGG - Intergenic
974097243 4:57376865-57376887 ATCTAAACCAAGGGGGGAAATGG - Intergenic
974476915 4:62393982-62394004 CTCATAAAAAAGAGGGAAAATGG + Intergenic
975559944 4:75699844-75699866 CTCATAAAGAATGTAGGAAATGG + Intronic
976129252 4:81867288-81867310 ATAAAAGAGAAGGGGGGAATGGG + Intronic
976396820 4:84564868-84564890 CTCAAAAAAAAGGGGGGGGGAGG + Intergenic
976433931 4:84995367-84995389 CCCAAAAAGAAGGCAAGAAAGGG - Intergenic
976505075 4:85836968-85836990 GCCAAAAAGGAGGGGGAAAAAGG + Intronic
976585143 4:86788901-86788923 CCTACAAAGAAGGGGGGAAATGG + Intronic
976656930 4:87498381-87498403 CTAGAGAAGAAGGGAGGAAAGGG + Intronic
976920452 4:90434883-90434905 GACGAAAAGAAGTGGGGAAAAGG - Intronic
977546442 4:98387386-98387408 CTTAAAACTCAGGGGGGAAAAGG + Intronic
978505463 4:109451542-109451564 AACAAAAAGATTGGGGGAAAAGG - Intronic
978932446 4:114331331-114331353 AGAAAAAAGAAGGTGGGAAAAGG + Intergenic
979820152 4:125161013-125161035 GTCCAAAAGAAAGGGGTAAAAGG + Intergenic
980297799 4:130944823-130944845 CAAAAACAGAAAGGGGGAAATGG + Intergenic
981162575 4:141516292-141516314 TTCAAAAGTTAGGGGGGAAATGG - Intergenic
981300265 4:143178888-143178910 CTCAAACTGAAGATGGGAAATGG - Intergenic
982069270 4:151681410-151681432 CTCAAAAGGAAGAGGGGCAGCGG + Intronic
982072436 4:151707185-151707207 GTCAGAAAGAAGGTGGTAAATGG + Intronic
982642418 4:157979966-157979988 CTTGAAAAGATGGGGGTAAATGG + Intergenic
982890377 4:160841689-160841711 AGGAAAACGAAGGGGGGAAAAGG - Intergenic
982898460 4:160965549-160965571 CTCAATAAAATTGGGGGAAAAGG - Intergenic
983861884 4:172717520-172717542 CTGAAAAGAAAGCGGGGAAAAGG + Intronic
984106229 4:175550156-175550178 ATCCAAAAGAAGGTAGGAAAGGG - Intergenic
984567718 4:181350640-181350662 CACAAGGATAAGGGGGGAAAAGG + Intergenic
984864849 4:184272625-184272647 ATCAAGAAGAAGGAGGAAAAAGG - Intergenic
985017492 4:185651692-185651714 CTCAAACAGAAGGGGAAAAAAGG + Intronic
986667326 5:10114944-10114966 CTCAAAAAAAAAGGGGGATGTGG + Intergenic
988428552 5:31092384-31092406 TTCTAAAATCAGGGGGGAAAGGG + Intergenic
988636914 5:32994777-32994799 GTTAAAAAAAAGGGGGGAGAGGG - Intergenic
989501101 5:42169225-42169247 CTTAAAAAGAAGCAGGGGAAGGG - Intergenic
990362648 5:55036664-55036686 ACCACAAAGAAGGGAGGAAATGG - Intergenic
990405480 5:55486239-55486261 CTCAAAGAAAAATGGGGAAAGGG - Intronic
990407217 5:55503774-55503796 CTCAAAACGAAGGAGAGGAAGGG + Intronic
992728185 5:79630574-79630596 CTCAAAAAGTAGTGGGGATGGGG + Intronic
993165067 5:84342408-84342430 CTCAGAAAGGTGGGGGGAATGGG + Intronic
993226588 5:85173545-85173567 GTCCATAAGGAGGGGGGAAAGGG + Intergenic
994105271 5:95940961-95940983 TGCAAAAAGAAGGGGGGGAGGGG + Intronic
995849144 5:116526126-116526148 ATAAAAAAGAAGGGGGGAAAAGG - Intronic
996073053 5:119156808-119156830 TTCATAAAGAAGTGGCGAAAAGG - Intronic
996304637 5:122033176-122033198 CTTAAAAATTAGGGGGAAAAAGG - Intronic
997064452 5:130545257-130545279 CTCAAACTGAAGATGGGAAATGG - Intergenic
997084058 5:130775407-130775429 CTCAAGGAGAAGGGAAGAAATGG + Intergenic
997576388 5:134980728-134980750 CTGATAAAGAAAGGAGGAAAGGG - Intronic
997757154 5:136409993-136410015 CTCAAAAAGAGGGTGGGACCAGG + Intergenic
998339196 5:141401340-141401362 CTCAAAAAAAAGGAAGGAGAAGG + Intronic
998656374 5:144184921-144184943 ATCAAAAAGAACAAGGGAAATGG - Intronic
999151820 5:149431371-149431393 CTCAAAAGTGAGGGGGCAAAAGG - Intergenic
999357328 5:150947389-150947411 CCCAAAAAGTAGGGTTGAAAGGG + Intergenic
999375272 5:151082066-151082088 CTCAAAAAGAATTAGGGGAAAGG + Intronic
999391041 5:151190808-151190830 CTCAAAAAAAAAGCAGGAAAGGG + Intronic
999750762 5:154626846-154626868 CTCAAAAAAAAGGGGGGGTTGGG + Intergenic
999812818 5:155144029-155144051 CTCAGAAAGAAGGGAGGAAAAGG - Intergenic
999990355 5:157044323-157044345 CTGAGAAAGAAGGAAGGAAAGGG + Intronic
1001170719 5:169416604-169416626 CTCAAAAAGACATGGGGGAAGGG + Intergenic
1001325005 5:170717249-170717271 CTCAAAAAGAAAGAAAGAAAAGG - Intronic
1001364940 5:171127714-171127736 CTGAAAAAGATGAGGTGAAAAGG + Intronic
1001955550 5:175846055-175846077 CTCAAAATGAAGGAAGGAAAAGG - Intronic
1002159912 5:177308964-177308986 TTCAACAAGAAGGGGAGAACTGG + Intronic
1002207566 5:177574145-177574167 CTCAAAAAGGCGGGAGGAAGTGG - Intergenic
1003315545 6:5008340-5008362 CTCATATAGAAGGAGGGGAAAGG - Intergenic
1003498910 6:6687804-6687826 CCCAAAAGGAAGGAGGGAGAGGG - Intergenic
1004441768 6:15661643-15661665 CTCAAAAAAAAGGGGGGTGGGGG + Intronic
1004606087 6:17196154-17196176 CTCATTAAAAAGGGAGGAAAAGG - Intergenic
1005575549 6:27186137-27186159 ATAAAACAGAAGAGGGGAAATGG + Intergenic
1006711196 6:36073025-36073047 CCCTAAAAGGAGGGGAGAAAGGG - Intronic
1006788706 6:36684828-36684850 CTCAAAAAGAAAGGCGGGCAGGG - Intronic
1006939296 6:37741347-37741369 CTCAAAAAAAAGGGGGGCGGGGG + Intergenic
1007215206 6:40231950-40231972 CTCACAAAGAAGATGGAAAAGGG + Intergenic
1007347180 6:41240367-41240389 CTCAAAAAAAAGGGGTGGGAAGG - Intergenic
1008405622 6:51115778-51115800 CTCTAAATGAAGGGAGGGAAAGG - Intergenic
1008849554 6:56008303-56008325 GACAAAAAGCAGGAGGGAAATGG - Intergenic
1009380260 6:63019195-63019217 CTCAAAGAGAGAGGGAGAAAGGG + Intergenic
1010497877 6:76557783-76557805 CTAAGTAAGAAGTGGGGAAAAGG - Intergenic
1010728200 6:79359690-79359712 CAAAAAAAGATTGGGGGAAAGGG - Intergenic
1010761144 6:79724650-79724672 CTAAAGAAGAAAGGGGGAATTGG - Intergenic
1010800394 6:80168388-80168410 CTCAAAAAGAAAGAAGGGAAGGG + Intronic
1011128630 6:84033078-84033100 ACAAAAAAGAAGGGAGGAAATGG - Intergenic
1012884988 6:104835315-104835337 AGCAAAAAGTAGGGGGAAAAAGG + Intronic
1013869520 6:114740394-114740416 TTAAAAAAGAAGAGGAGAAAAGG + Intergenic
1014579313 6:123115955-123115977 CTACAAAAGAAGGGAAGAAAAGG - Intergenic
1015473361 6:133631821-133631843 AACAAAAAGAATGGGGAAAAAGG + Intergenic
1015571998 6:134631434-134631456 CTAAAAAAGAAGGTGAAAAAAGG - Intergenic
1016521890 6:144955079-144955101 AAAAAAAAGAAGGAGGGAAATGG - Intergenic
1016530504 6:145054038-145054060 CTCTAAAAGAAGGGGGGTCTGGG + Intergenic
1016660826 6:146577573-146577595 CTCAAAAAAATAGGGGAAAAGGG + Intergenic
1016754322 6:147666978-147667000 CTCGGAAAAAATGGGGGAAAGGG - Intronic
1016994043 6:149948308-149948330 CTCAAGAAGAAGGGGAAAGAAGG + Intronic
1017004296 6:150019249-150019271 CTCAAGAAGAAGGGGAAAGAAGG - Intronic
1017233594 6:152097742-152097764 CAGGAAAACAAGGGGGGAAATGG - Intronic
1017898584 6:158701971-158701993 CTCAAAAACAAGAAGGGAAGGGG - Intronic
1018285923 6:162237607-162237629 CACAAAAAGAAGGTGGAGAAAGG + Intronic
1018361845 6:163078492-163078514 CTCAAAAAAAAAGGGGGGGAGGG + Intronic
1019531799 7:1506900-1506922 TTCAAAAAGAGGCGGGGAGAGGG - Intergenic
1019848393 7:3528890-3528912 CTCAAAAGCAAGGGGAGAGAAGG - Intronic
1020984809 7:15120188-15120210 TTCAAAGAGAATGGGAGAAAAGG - Intergenic
1022096150 7:27142840-27142862 CTCACAAATAGTGGGGGAAATGG - Intronic
1022374827 7:29803704-29803726 ATCATAAAGAAAGTGGGAAATGG + Intergenic
1022594107 7:31695504-31695526 CTCAAAAAGAAGCCTAGAAAGGG + Exonic
1022742711 7:33138339-33138361 CTGAAAAAGAAGGGGAAAACTGG + Intronic
1022756342 7:33295491-33295513 TTTTAAAAGATGGGGGGAAATGG - Intronic
1023064307 7:36361264-36361286 ATCTAAAAGAATGGGGGAAAAGG + Intronic
1023445100 7:40223061-40223083 CTCAAAAAGAAAGAAAGAAATGG - Intronic
1023489632 7:40725071-40725093 CTCAATGAGAAGTGGGGAACAGG - Intronic
1023741477 7:43285167-43285189 CTCAAGACAAAAGGGGGAAATGG + Intronic
1023897252 7:44444301-44444323 CTCAGAAAGAAGAGGGGCAGAGG - Intronic
1026092079 7:67308705-67308727 ATCAAAAAGAAGGGGATAATAGG - Intergenic
1026347166 7:69483924-69483946 CTCAAAAAAAAGGGGGGGGAGGG + Intergenic
1026814151 7:73496247-73496269 ATCAAAAAGAAGAGGGAAACTGG + Intronic
1027184430 7:75962292-75962314 CTCAAAAAAAAGGGAGGAGGGGG - Intronic
1027941445 7:84686193-84686215 CTTAAAAAGAAAGGGGGAAAGGG - Intergenic
1028680663 7:93526384-93526406 ATAGCAAAGAAGGGGGGAAAAGG + Intronic
1028697379 7:93730833-93730855 CACAAAGAGAAAGGGGGCAATGG + Intronic
1028819623 7:95191275-95191297 CTCAACATGAAGGGGAGAGAGGG + Intronic
1028973671 7:96888439-96888461 TTCAAAAATAATTGGGGAAAGGG + Intergenic
1029377508 7:100188582-100188604 ATCAAAAAGAAGGGGATAATAGG - Intronic
1029489421 7:100862257-100862279 CTCAAAAAAAAGCGGGGGAGGGG - Intronic
1030050720 7:105534771-105534793 CTGAACAGGAAAGGGGGAAAAGG + Intronic
1030769192 7:113452668-113452690 GTGAAAAAGAAGAGGGAAAATGG + Intergenic
1031136238 7:117887391-117887413 CGTAAAAAGAAGGTGGGGAATGG - Intergenic
1031183919 7:118451802-118451824 CTAATAAAGGAAGGGGGAAATGG - Intergenic
1031317834 7:120278914-120278936 CTCAGAAAGAAGGGATGAAATGG - Intronic
1031429410 7:121648183-121648205 CACAAAAACAATGAGGGAAAGGG - Intergenic
1031439737 7:121779279-121779301 GTCATAAAGAGGGGAGGAAATGG - Intergenic
1031745422 7:125490593-125490615 AGCAAAAAGAAGGTGGTAAAAGG - Intergenic
1033603946 7:142911432-142911454 GTTAAAAGGAAGGAGGGAAAAGG - Intronic
1033662368 7:143410909-143410931 AGCCAACAGAAGGGGGGAAATGG + Intergenic
1033791712 7:144798312-144798334 CTGAAAAAGACAGGGGGAACGGG + Intronic
1034325478 7:150227290-150227312 CTAAAAATGAAGGAGAGAAATGG - Intergenic
1034580745 7:152039981-152040003 CAAAAACAGAAAGGGGGAAATGG - Intronic
1034733451 7:153408443-153408465 ATCAAATAGAAGGCAGGAAAAGG - Intergenic
1034767721 7:153741960-153741982 CTAAAAACGAAGGAGAGAAATGG + Intergenic
1035980141 8:4361231-4361253 CTCAAAAAGCAGGAAGGAAAAGG + Intronic
1036021368 8:4850901-4850923 CACAAAAAGTGGGGGGGCAAGGG - Intronic
1036109379 8:5880419-5880441 AACAAAAACAAGGTGGGAAAAGG + Intergenic
1036573578 8:10003351-10003373 CACAAAAAGAAGGGAGTAAGTGG + Intergenic
1037916071 8:22774251-22774273 CCCAAAAGGAAGGGAGGAAGTGG - Intronic
1038298381 8:26318115-26318137 CTAAAGGAGAAAGGGGGAAATGG + Intronic
1038714856 8:29982455-29982477 CTCAAAAAGAGAGAGGGAGAGGG + Intergenic
1038998908 8:32957732-32957754 CTCCAAAAGGAGAGGAGAAAAGG - Intergenic
1040560034 8:48515497-48515519 GTTTAAATGAAGGGGGGAAAAGG - Intergenic
1040986862 8:53304832-53304854 TTCAAACTGCAGGGGGGAAAAGG + Intergenic
1041513793 8:58677602-58677624 CTCAAAAGGAAGAGGGTAAGAGG + Intergenic
1042488433 8:69372262-69372284 ATTAAACTGAAGGGGGGAAAAGG + Intergenic
1044026628 8:87180725-87180747 CTAAAAAAGAAGGAAGGAATGGG + Intronic
1044123172 8:88423771-88423793 CTCAAAAAAAAAGGAAGAAAAGG - Intergenic
1044516643 8:93146658-93146680 CTCCAAAAGAAAGAGGGCAAGGG - Intronic
1044561196 8:93613831-93613853 TTGAAAAACAAGAGGGGAAAAGG + Intergenic
1044798109 8:95924704-95924726 TTGAAATAAAAGGGGGGAAATGG - Intergenic
1045237830 8:100371462-100371484 TCCAAAGAGAAAGGGGGAAATGG - Intronic
1045355232 8:101381607-101381629 CACAGAAAGGAGGGGGAAAATGG - Intergenic
1045750845 8:105482322-105482344 CTAAAAAAGAAAAGAGGAAAAGG - Intronic
1046080340 8:109363008-109363030 CCCAAGAAGAATGGAGGAAAAGG - Intronic
1046791971 8:118332092-118332114 TTCAAAAAAAAGGGGGACAAAGG + Intronic
1047234140 8:123024306-123024328 CCCTCAAAGGAGGGGGGAAAGGG + Intronic
1047403582 8:124566602-124566624 CTCAATTAGAATGGGAGAAATGG + Intronic
1048036768 8:130684575-130684597 CTCAAAACGGTGGAGGGAAAGGG + Intergenic
1049999192 9:1058328-1058350 CTCAAAAAAAAGGGGGGGTGGGG - Intergenic
1050212824 9:3282728-3282750 CAAATAAAGAAGGTGGGAAAGGG - Intronic
1050556252 9:6792020-6792042 CTCAAAAAGAAAAAGAGAAAAGG + Intronic
1051234389 9:14983367-14983389 CTCAATAAGGCTGGGGGAAAAGG - Intergenic
1051434673 9:17018332-17018354 CTCAACAAGAAGGGGTGTTAAGG - Intergenic
1052039323 9:23720170-23720192 CTCAAAAAAAAAAGGTGAAAGGG - Intronic
1052393106 9:27904407-27904429 CTCAAAAAGCAGGCAGGGAAGGG + Intergenic
1052685756 9:31753523-31753545 CTCAAGAAGAAGGAGGGGGAGGG - Intergenic
1053156855 9:35787228-35787250 CTCAAAAAAAAAGGGGGCAGCGG - Intergenic
1053440155 9:38109381-38109403 CTCAAAAAAAAGGGGGGGGTGGG - Intergenic
1053786642 9:41657242-41657264 CTCACAAAGAAGGAGATAAATGG - Intergenic
1054158418 9:61656953-61656975 CTCACAAAGAAGGAGATAAATGG + Intergenic
1054450331 9:65400463-65400485 CTCACAAAGAAGGAGATAAATGG - Intergenic
1054478191 9:65587958-65587980 CTCACAAAGAAGGAGATAAATGG + Intergenic
1054829554 9:69608397-69608419 CTCAAAAGGAAAGGGGGAGTAGG + Intronic
1055274015 9:74593663-74593685 CTCCATAAGAAGGGGTGAATTGG + Intronic
1057538070 9:95935485-95935507 CTCAAAAAGTAGAGGGGTACAGG + Intronic
1058072124 9:100612007-100612029 CTCAAAAAGCAGGCTTGAAAGGG - Intergenic
1058629356 9:106970577-106970599 TTCAAAAAGCAGGGGGGAAAGGG - Intronic
1059218368 9:112588835-112588857 CACCAAAACAAGGGGGAAAAAGG - Intronic
1059323340 9:113486288-113486310 CTAAAGAAGAAGGTTGGAAATGG + Intronic
1059692459 9:116698814-116698836 CTCAAGAAGATGGGGGCCAAAGG + Exonic
1059817533 9:117934369-117934391 CTCAGAAGGAAGGTGGGAAAAGG + Intergenic
1060251731 9:121991841-121991863 CTCAAAAGTCAAGGGGGAAACGG + Intronic
1060909377 9:127337168-127337190 CTCAGAAAGCAGGGATGAAAAGG - Intronic
1061466967 9:130788323-130788345 CACATATAGAAGGGGGGAAATGG - Intronic
1186123221 X:6384932-6384954 CATAAAGAGAAGTGGGGAAAGGG + Intergenic
1186840417 X:13479454-13479476 CCCAAAAAGAAGGAAGGAAAGGG + Intergenic
1187133198 X:16522424-16522446 CTCCAAAAGGAGGGAGGAAGGGG + Intergenic
1187436214 X:19272311-19272333 CTTAAAAAAAGGGAGGGAAATGG - Intergenic
1187678294 X:21740117-21740139 CTCAGGAAGAAGGGGGTTAATGG + Intronic
1187797455 X:23019911-23019933 CTCAAACAGAAGGGGAAACAGGG + Intergenic
1188163989 X:26838697-26838719 CTCATTAAAAAGTGGGGAAAAGG - Intergenic
1189404841 X:40712055-40712077 CTCAAAAAGGGTGGGGGAGATGG + Intronic
1189419674 X:40845709-40845731 CACAAAAACATGGGGGGAAGGGG - Intergenic
1189439925 X:41026188-41026210 GGCAAAAAGAAGGGGGAGAAGGG + Intergenic
1189473218 X:41330441-41330463 CTCAAAAAGAAGGCGGGGGTGGG - Intergenic
1191718125 X:64206587-64206609 CTCACAAAGGATGGGGGAAGGGG - Intergenic
1191992324 X:67051679-67051701 TTCATTAAGAAGGGGGAAAATGG + Intergenic
1192211488 X:69130744-69130766 GTCACAAAGGAGGGGGGAAAGGG - Intergenic
1192741772 X:73900297-73900319 CTCAAAAAAAAGGGGAGAGTGGG + Intergenic
1193625006 X:83808037-83808059 TTAAAAAAAAAGGGGGGAGAAGG - Intergenic
1193928138 X:87516389-87516411 TACAAAAACAAGAGGGGAAAGGG + Intergenic
1194139334 X:90190604-90190626 CTCAAAAAGAAGAAAGAAAAAGG + Intergenic
1194681391 X:96858385-96858407 CTCAAACAGATGTGGTGAAATGG + Intronic
1194978251 X:100414208-100414230 GGCAAAGAGAAGGGGGCAAAAGG - Intergenic
1195177245 X:102322952-102322974 CTCACACAGAAGGGGGGGAGGGG - Intronic
1195181619 X:102364141-102364163 CTCACACAGAAGGGGGGGAGGGG + Intronic
1195633196 X:107082053-107082075 GTCAAAAAGAAGTGGGGAAAGGG + Intronic
1195814668 X:108871715-108871737 CACATAAAGAAGGGAGGAGAAGG + Intergenic
1196460357 X:115923276-115923298 CACAAAAAGAACGGGTAAAAAGG + Intergenic
1196648261 X:118141224-118141246 GTCAAAAAGAAAGGGGGAAAAGG + Intergenic
1196740622 X:119022164-119022186 TTCAAACAGAAGGAAGGAAAAGG + Intergenic
1196994599 X:121368022-121368044 ATCAAAAATGAGGGGGGAAAAGG + Intergenic
1198672719 X:139098724-139098746 CTCCAAAAGTAGGGGAGGAAGGG + Intronic
1199075403 X:143520071-143520093 CTCAAAAACAAGAGGTGAAAAGG - Intergenic
1199433791 X:147789798-147789820 CTAAAAAGGAAGGGGGAGAATGG - Intergenic
1199900634 X:152168573-152168595 AGGAAAAAGAGGGGGGGAAAGGG + Intronic
1200306900 X:155035283-155035305 CACATAAAGCAGCGGGGAAAGGG - Intronic
1201253861 Y:12088163-12088185 GAGAATAAGAAGGGGGGAAATGG - Intergenic
1201554789 Y:15256675-15256697 CCCCAAAAGAAGAGGGAAAAGGG + Intergenic
1202160895 Y:21935185-21935207 CTTGAAAACTAGGGGGGAAAAGG + Intergenic
1202230461 Y:22651188-22651210 CTTGAAAACTAGGGGGGAAAAGG - Intergenic
1202312696 Y:23544977-23544999 CTTGAAAACTAGGGGGGAAAAGG + Intergenic
1202558106 Y:26125617-26125639 CTTGAAAACTAGGGGGGAAAAGG - Intergenic